Incidental Mutation 'R0009:Naa15'
ID40456
Institutional Source Beutler Lab
Gene Symbol Naa15
Ensembl Gene ENSMUSG00000063273
Gene NameN(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonymstubedown, ASTBDN, Tbdn-1, mNAT1, 5730450D16Rik, Narg1
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R0009 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51415148-51476507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 51470219 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 763 (H763Q)
Ref Sequence ENSEMBL: ENSMUSP00000029303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029303] [ENSMUST00000193266]
Predicted Effect probably damaging
Transcript: ENSMUST00000029303
AA Change: H763Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029303
Gene: ENSMUSG00000063273
AA Change: H763Q

DomainStartEndE-ValueType
TPR 46 79 6.24e1 SMART
TPR 80 113 1.01e0 SMART
Blast:TPR 224 257 3e-12 BLAST
TPR 374 407 1.87e1 SMART
TPR 408 441 5.06e1 SMART
low complexity region 603 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192523
Predicted Effect probably damaging
Transcript: ENSMUST00000193266
AA Change: H713Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141433
Gene: ENSMUSG00000063273
AA Change: H713Q

DomainStartEndE-ValueType
Blast:TPR 1 29 3e-10 BLAST
TPR 30 63 4.9e-3 SMART
Blast:TPR 174 207 3e-12 BLAST
TPR 324 357 8.9e-2 SMART
TPR 358 391 2.4e-1 SMART
coiled coil region 533 585 N/A INTRINSIC
Blast:TPR 622 655 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193267
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes the auxillary subunit of the N-terminal acetyltransferase A (NatA) complex. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Naa15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Naa15 APN 3 51438405 missense probably damaging 1.00
IGL01753:Naa15 APN 3 51442853 missense probably damaging 1.00
IGL01837:Naa15 APN 3 51443948 nonsense probably null
IGL02619:Naa15 APN 3 51460131 missense probably benign 0.03
IGL02691:Naa15 APN 3 51451326 missense probably damaging 0.97
IGL02974:Naa15 APN 3 51461207 missense possibly damaging 0.95
R0010:Naa15 UTSW 3 51436213 critical splice acceptor site probably null
R0114:Naa15 UTSW 3 51448438 critical splice donor site probably null
R0411:Naa15 UTSW 3 51465639 missense possibly damaging 0.81
R1348:Naa15 UTSW 3 51465670 missense probably damaging 1.00
R1941:Naa15 UTSW 3 51455934 nonsense probably null
R3082:Naa15 UTSW 3 51460050 missense probably damaging 1.00
R4377:Naa15 UTSW 3 51448365 missense possibly damaging 0.91
R4591:Naa15 UTSW 3 51441924 missense probably damaging 1.00
R4980:Naa15 UTSW 3 51458752 critical splice donor site probably null
R5087:Naa15 UTSW 3 51457285 splice site probably null
R5139:Naa15 UTSW 3 51443840 missense probably damaging 1.00
R5289:Naa15 UTSW 3 51455894 missense probably damaging 1.00
R5527:Naa15 UTSW 3 51441947 missense probably damaging 1.00
R5776:Naa15 UTSW 3 51460026 missense probably damaging 0.96
R5909:Naa15 UTSW 3 51460064 missense probably damaging 1.00
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6194:Naa15 UTSW 3 51463300 missense probably benign 0.00
R6291:Naa15 UTSW 3 51442791 missense probably damaging 1.00
R6522:Naa15 UTSW 3 51471514 missense probably damaging 1.00
R6731:Naa15 UTSW 3 51455873 missense probably damaging 1.00
R6984:Naa15 UTSW 3 51472600 missense probably benign 0.10
R7040:Naa15 UTSW 3 51472784 missense possibly damaging 0.89
R7091:Naa15 UTSW 3 51458756 splice site probably null
R7380:Naa15 UTSW 3 51459847 intron probably null
R7685:Naa15 UTSW 3 51469974 intron probably null
R7781:Naa15 UTSW 3 51471483 critical splice acceptor site probably null
R7797:Naa15 UTSW 3 51448610 missense probably damaging 0.99
R7836:Naa15 UTSW 3 51463267 nonsense probably null
R7919:Naa15 UTSW 3 51463267 nonsense probably null
X0020:Naa15 UTSW 3 51470132 missense probably benign 0.00
X0061:Naa15 UTSW 3 51448600 missense probably damaging 1.00
X0061:Naa15 UTSW 3 51448601 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCACAATTAGAGTAGCACACTGTAGC -3'
(R):5'- GAAGCATGTAAACATTGCCTGTTCTCC -3'

Sequencing Primer
(F):5'- GAGTAGCACACTGTAGCTTTTTC -3'
(R):5'- ATTGCCTGTTCTCCTAGTATTAAAAG -3'
Posted On2013-05-23