Incidental Mutation 'R0009:Atp1a1'
ID 40457
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene Name ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms Atpa-1
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0009 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 101483535-101512000 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101487151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 886 (I886N)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
AlphaFold Q8VDN2
Predicted Effect possibly damaging
Transcript: ENSMUST00000036493
AA Change: I886N

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: I886N

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197360
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,482 (GRCm39) probably benign Het
Abcg4 T G 9: 44,188,946 (GRCm39) probably benign Het
Afm C A 5: 90,693,243 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aplnr T A 2: 84,967,620 (GRCm39) probably null Het
Arih2 T A 9: 108,488,926 (GRCm39) H264L probably damaging Het
Bmf A T 2: 118,380,103 (GRCm39) V14E probably damaging Het
Ccdc116 T C 16: 16,961,903 (GRCm39) E15G probably damaging Het
Ccdc175 T C 12: 72,182,739 (GRCm39) N427D possibly damaging Het
Cfap53 A G 18: 74,432,247 (GRCm39) H45R probably benign Het
Chd3 A G 11: 69,240,732 (GRCm39) L1569P probably damaging Het
Cntn2 G A 1: 132,443,918 (GRCm39) Q457* probably null Het
Coro1a A T 7: 126,300,585 (GRCm39) probably benign Het
Cracr2b T A 7: 141,043,672 (GRCm39) L91Q probably damaging Het
Ctdspl T C 9: 118,849,114 (GRCm39) probably null Het
Dip2b T A 15: 100,067,193 (GRCm39) L565Q probably damaging Het
Dip2c T A 13: 9,671,939 (GRCm39) C1004S probably damaging Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah14 A G 1: 181,596,972 (GRCm39) probably benign Het
Dnase1 T C 16: 3,856,810 (GRCm39) V147A probably damaging Het
Dusp8 T C 7: 141,635,791 (GRCm39) probably benign Het
Fer1l6 T C 15: 58,534,636 (GRCm39) Y1828H probably damaging Het
Flvcr1 A G 1: 190,740,388 (GRCm39) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm39) V311A probably benign Het
Glud1 G A 14: 34,056,225 (GRCm39) G300S probably benign Het
Gm4847 C T 1: 166,458,055 (GRCm39) V433I probably benign Het
Gstm3 T G 3: 107,875,156 (GRCm39) Y62S probably damaging Het
Gtse1 C T 15: 85,746,636 (GRCm39) P151S probably benign Het
Herc2 T C 7: 55,857,560 (GRCm39) S4048P probably benign Het
Hp1bp3 T A 4: 137,948,994 (GRCm39) I19K probably benign Het
Htr7 C A 19: 36,018,940 (GRCm39) probably benign Het
Il1a C T 2: 129,150,994 (GRCm39) D10N probably damaging Het
Il22ra2 A T 10: 19,500,206 (GRCm39) N39I probably damaging Het
Kcnn4 T C 7: 24,078,680 (GRCm39) C267R possibly damaging Het
Larp1 A G 11: 57,946,299 (GRCm39) K879R possibly damaging Het
Lcn5 T A 2: 25,551,417 (GRCm39) probably benign Het
Lep T A 6: 29,068,971 (GRCm39) C7* probably null Het
Magi2 A T 5: 20,816,053 (GRCm39) Y747F probably benign Het
Mast4 T C 13: 102,878,566 (GRCm39) T1223A probably damaging Het
Mcc C T 18: 44,579,000 (GRCm39) E803K probably damaging Het
Mtmr4 T C 11: 87,502,334 (GRCm39) I796T probably benign Het
Myef2 A T 2: 124,950,898 (GRCm39) D312E probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo19 T A 11: 84,778,995 (GRCm39) probably null Het
Naa15 T G 3: 51,377,640 (GRCm39) H763Q probably damaging Het
Pde5a C T 3: 122,618,551 (GRCm39) probably benign Het
Plpp2 C T 10: 79,363,078 (GRCm39) R184H probably benign Het
Rab19 T G 6: 39,366,621 (GRCm39) L179V probably damaging Het
Rims2 T A 15: 39,398,362 (GRCm39) M1087K probably damaging Het
Riox2 C A 16: 59,309,730 (GRCm39) D361E probably benign Het
Sh3rf1 T A 8: 61,679,327 (GRCm39) V123E probably damaging Het
Slc35e1 A T 8: 73,238,553 (GRCm39) N318K probably damaging Het
Slc9a2 A T 1: 40,802,762 (GRCm39) E604V probably benign Het
Srp72 T C 5: 77,135,732 (GRCm39) S221P probably damaging Het
Tbx19 A T 1: 164,988,089 (GRCm39) S15T possibly damaging Het
Tcea2 A G 2: 181,327,610 (GRCm39) T112A probably benign Het
Tesk1 T A 4: 43,445,368 (GRCm39) D230E probably damaging Het
Tm4sf5 C T 11: 70,401,538 (GRCm39) A179V probably damaging Het
Tnr G T 1: 159,679,986 (GRCm39) G320V probably damaging Het
Trappc11 A T 8: 47,956,355 (GRCm39) C874S possibly damaging Het
Trpm3 T A 19: 22,891,810 (GRCm39) Y885N probably damaging Het
Unc5a T A 13: 55,150,692 (GRCm39) C505S probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Xpo5 T C 17: 46,515,712 (GRCm39) probably benign Het
Zfp637 C A 6: 117,822,629 (GRCm39) H252Q probably damaging Het
Zfp646 T A 7: 127,479,903 (GRCm39) D693E probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101,498,769 (GRCm39) missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101,501,574 (GRCm39) missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101,498,730 (GRCm39) missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101,499,205 (GRCm39) nonsense probably null
IGL02021:Atp1a1 APN 3 101,501,524 (GRCm39) missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101,499,179 (GRCm39) missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101,483,894 (GRCm39) missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101,484,308 (GRCm39) nonsense probably null
IGL03068:Atp1a1 APN 3 101,491,175 (GRCm39) missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101,488,495 (GRCm39) missense probably benign 0.01
R0506:Atp1a1 UTSW 3 101,497,128 (GRCm39) missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101,499,755 (GRCm39) missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101,492,169 (GRCm39) missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101,497,782 (GRCm39) missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101,492,115 (GRCm39) missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101,489,333 (GRCm39) missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101,497,864 (GRCm39) missense probably benign
R3770:Atp1a1 UTSW 3 101,488,510 (GRCm39) missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101,497,928 (GRCm39) missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101,494,259 (GRCm39) missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101,494,259 (GRCm39) missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101,499,122 (GRCm39) missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101,502,312 (GRCm39) critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101,491,091 (GRCm39) missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101,487,133 (GRCm39) missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101,489,420 (GRCm39) missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101,489,105 (GRCm39) missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101,498,443 (GRCm39) missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101,497,280 (GRCm39) missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101,489,411 (GRCm39) missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101,498,741 (GRCm39) missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101,497,090 (GRCm39) missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101,498,023 (GRCm39) missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101,493,614 (GRCm39) missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101,497,188 (GRCm39) missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101,489,437 (GRCm39) nonsense probably null
R7825:Atp1a1 UTSW 3 101,493,485 (GRCm39) missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101,489,365 (GRCm39) missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101,492,170 (GRCm39) missense possibly damaging 0.79
R8281:Atp1a1 UTSW 3 101,486,940 (GRCm39) missense probably benign 0.12
R8403:Atp1a1 UTSW 3 101,494,220 (GRCm39) missense probably damaging 1.00
R8435:Atp1a1 UTSW 3 101,490,078 (GRCm39) missense probably benign
R8461:Atp1a1 UTSW 3 101,496,405 (GRCm39) missense probably benign 0.01
R8772:Atp1a1 UTSW 3 101,487,124 (GRCm39) missense probably benign
R8782:Atp1a1 UTSW 3 101,501,533 (GRCm39) missense possibly damaging 0.63
R8919:Atp1a1 UTSW 3 101,498,547 (GRCm39) missense probably damaging 1.00
R9066:Atp1a1 UTSW 3 101,489,338 (GRCm39) missense probably damaging 1.00
R9227:Atp1a1 UTSW 3 101,499,750 (GRCm39) missense probably damaging 1.00
R9712:Atp1a1 UTSW 3 101,498,757 (GRCm39) missense probably benign 0.06
X0019:Atp1a1 UTSW 3 101,501,529 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCAGGTGAACTCCACGATCTTC -3'
(R):5'- ATTGGGTTTGTGCCCTGACAGAGC -3'

Sequencing Primer
(F):5'- CCTCTGCTCGTAGGTCTGAAAG -3'
(R):5'- TCAGCACTTAAGGGACAGTC -3'
Posted On 2013-05-23