Mutagenetix > Incidental Mutation

Incidental Mutation 'R0009:Atp1a1'

40457

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

038304-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0009 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101579835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 886 (I886N)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036493
AA Change: I886N

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: I886N

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130649

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197360

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	G	15: 60,919,633		probably benign	Het
Abcg4	T	G	9: 44,277,649		probably benign	Het
Afm	C	A	5: 90,545,384		probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aplnr	T	A	2: 85,137,276		probably null	Het
Arih2	T	A	9: 108,611,727	H264L	probably damaging	Het
Bmf	A	T	2: 118,549,622	V14E	probably damaging	Het
Ccdc116	T	C	16: 17,144,039	E15G	probably damaging	Het
Ccdc175	T	C	12: 72,135,965	N427D	possibly damaging	Het
Cfap53	A	G	18: 74,299,176	H45R	probably benign	Het
Chd3	A	G	11: 69,349,906	L1569P	probably damaging	Het
Cntn2	G	A	1: 132,516,180	Q457*	probably null	Het
Coro1a	A	T	7: 126,701,413		probably benign	Het
Cracr2b	T	A	7: 141,463,759	L91Q	probably damaging	Het
Ctdspl	T	C	9: 119,020,046		probably null	Het
Dip2b	T	A	15: 100,169,312	L565Q	probably damaging	Het
Dip2c	T	A	13: 9,621,903	C1004S	probably damaging	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah14	A	G	1: 181,769,407		probably benign	Het
Dnase1	T	C	16: 4,038,946	V147A	probably damaging	Het
Dusp8	T	C	7: 142,082,054		probably benign	Het
Fer1l6	T	C	15: 58,662,787	Y1828H	probably damaging	Het
Flvcr1	A	G	1: 191,008,191	V544A	probably benign	Het
Fsd1l	T	C	4: 53,687,209	V311A	probably benign	Het
Glud1	G	A	14: 34,334,268	G300S	probably benign	Het
Gm4847	C	T	1: 166,630,486	V433I	probably benign	Het
Gstm3	T	G	3: 107,967,840	Y62S	probably damaging	Het
Gtse1	C	T	15: 85,862,435	P151S	probably benign	Het
Herc2	T	C	7: 56,207,812	S4048P	probably benign	Het
Hp1bp3	T	A	4: 138,221,683	I19K	probably benign	Het
Htr7	C	A	19: 36,041,540		probably benign	Het
Il1a	C	T	2: 129,309,074	D10N	probably damaging	Het
Il22ra2	A	T	10: 19,624,458	N39I	probably damaging	Het
Kcnn4	T	C	7: 24,379,255	C267R	possibly damaging	Het
Larp1	A	G	11: 58,055,473	K879R	possibly damaging	Het
Lcn5	T	A	2: 25,661,405		probably benign	Het
Lep	T	A	6: 29,068,972	C7*	probably null	Het
Magi2	A	T	5: 20,611,055	Y747F	probably benign	Het
Mast4	T	C	13: 102,742,058	T1223A	probably damaging	Het
Mcc	C	T	18: 44,445,933	E803K	probably damaging	Het
Mtmr4	T	C	11: 87,611,508	I796T	probably benign	Het
Myef2	A	T	2: 125,108,978	D312E	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Myo19	T	A	11: 84,888,169		probably null	Het
Naa15	T	G	3: 51,470,219	H763Q	probably damaging	Het
Pde5a	C	T	3: 122,824,902		probably benign	Het
Plpp2	C	T	10: 79,527,244	R184H	probably benign	Het
Rab19	T	G	6: 39,389,687	L179V	probably damaging	Het
Rims2	T	A	15: 39,534,966	M1087K	probably damaging	Het
Riox2	C	A	16: 59,489,367	D361E	probably benign	Het
Sh3rf1	T	A	8: 61,226,293	V123E	probably damaging	Het
Slc35e1	A	T	8: 72,484,709	N318K	probably damaging	Het
Slc9a2	A	T	1: 40,763,602	E604V	probably benign	Het
Srp72	T	C	5: 76,987,885	S221P	probably damaging	Het
Tbx19	A	T	1: 165,160,520	S15T	possibly damaging	Het
Tcea2	A	G	2: 181,685,817	T112A	probably benign	Het
Tesk1	T	A	4: 43,445,368	D230E	probably damaging	Het
Tm4sf5	C	T	11: 70,510,712	A179V	probably damaging	Het
Tnr	G	T	1: 159,852,416	G320V	probably damaging	Het
Trappc11	A	T	8: 47,503,320	C874S	possibly damaging	Het
Trpm3	T	A	19: 22,914,446	Y885N	probably damaging	Het
Unc5a	T	A	13: 55,002,879	C505S	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Xpo5	T	C	17: 46,204,786		probably benign	Het
Zfp637	C	A	6: 117,845,668	H252Q	probably damaging	Het
Zfp646	T	A	7: 127,880,731	D693E	probably damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
R9712:Atp1a1	UTSW	3	101591441	missense	probably benign	0.06
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGCAGGTGAACTCCACGATCTTC -3'
(R):5'- ATTGGGTTTGTGCCCTGACAGAGC -3'

Sequencing Primer
(F):5'- CCTCTGCTCGTAGGTCTGAAAG -3'
(R):5'- TCAGCACTTAAGGGACAGTC -3'

Posted On

2013-05-23