Incidental Mutation 'R5306:Olfr814'
ID 404572
Institutional Source Beutler Lab
Gene Symbol Olfr814
Ensembl Gene ENSMUSG00000059134
Gene Name olfactory receptor 814
Synonyms MOR113-5, MOR113-8, GA_x6K02T2PULF-11553313-11552381
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5306 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 129871473-129879851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 129873941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 272 (I272R)
Ref Sequence ENSEMBL: ENSMUSP00000150458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
AlphaFold Q7TRH4
Predicted Effect probably damaging
Transcript: ENSMUST00000081367
AA Change: I272R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: I272R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213742
AA Change: I272R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216966
AA Change: I272R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Olfr814
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Olfr814 APN 10 129874031 missense probably damaging 1.00
IGL02045:Olfr814 APN 10 129874222 missense probably benign 0.22
IGL02301:Olfr814 APN 10 129874079 missense probably damaging 0.99
R0277:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0281:Olfr814 UTSW 10 129874546 missense possibly damaging 0.88
R0323:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0394:Olfr814 UTSW 10 129873942 missense probably benign 0.29
R0546:Olfr814 UTSW 10 129874538 missense possibly damaging 0.94
R3813:Olfr814 UTSW 10 129873986 missense probably damaging 1.00
R4086:Olfr814 UTSW 10 129874298 missense possibly damaging 0.49
R4415:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4416:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4453:Olfr814 UTSW 10 129874661 missense probably null 0.30
R5194:Olfr814 UTSW 10 129874098 missense probably benign 0.00
R5362:Olfr814 UTSW 10 129874553 missense probably damaging 1.00
R5609:Olfr814 UTSW 10 129874738 missense probably benign 0.01
R5987:Olfr814 UTSW 10 129874521 missense probably damaging 0.98
R6240:Olfr814 UTSW 10 129874677 missense probably benign
R6896:Olfr814 UTSW 10 129874754 start codon destroyed probably null 0.98
R7432:Olfr814 UTSW 10 129873850 missense probably benign
R7489:Olfr814 UTSW 10 129874682 missense probably damaging 1.00
R7652:Olfr814 UTSW 10 129874477 missense probably damaging 0.99
R8316:Olfr814 UTSW 10 129874022 missense probably damaging 1.00
R8725:Olfr814 UTSW 10 129874223 missense probably damaging 1.00
R8727:Olfr814 UTSW 10 129874223 missense probably damaging 1.00
R9089:Olfr814 UTSW 10 129874619 missense probably damaging 1.00
R9538:Olfr814 UTSW 10 129873893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTTCCTGGAGTACTTTTAGCCTG -3'
(R):5'- GATGGCTTTCATCTTAGCTCTCATG -3'

Sequencing Primer
(F):5'- GGAGTACTTTTAGCCTGTTTAATACC -3'
(R):5'- ATCTTAGCTCTCATGACACTCATTG -3'
Posted On 2016-07-22