Incidental Mutation 'R5306:Or6c70'
ID 404572
Institutional Source Beutler Lab
Gene Symbol Or6c70
Ensembl Gene ENSMUSG00000059134
Gene Name olfactory receptor family 6 subfamily C member 70
Synonyms MOR113-8, MOR113-5, Olfr814, GA_x6K02T2PULF-11553313-11552381
MMRRC Submission 042889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R5306 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 129709692-129710624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 129709810 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 272 (I272R)
Ref Sequence ENSEMBL: ENSMUSP00000150458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
AlphaFold Q7TRH4
Predicted Effect probably damaging
Transcript: ENSMUST00000081367
AA Change: I272R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: I272R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213742
AA Change: I272R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216966
AA Change: I272R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 56,324,792 (GRCm39) D554V probably damaging Het
Ankrd44 G A 1: 54,965,362 (GRCm39) probably benign Het
Api5 A T 2: 94,253,811 (GRCm39) C297* probably null Het
Asb14 G A 14: 26,633,866 (GRCm39) C357Y probably damaging Het
Brd10 A G 19: 29,707,230 (GRCm39) probably benign Het
Brdt T A 5: 107,493,010 (GRCm39) D112E probably damaging Het
Capsl C A 15: 9,457,876 (GRCm39) Q32K probably benign Het
Ccdc106 A G 7: 5,061,096 (GRCm39) D81G probably damaging Het
Ccdc121rt3 T C 5: 112,502,910 (GRCm39) R265G probably benign Het
Cep104 C A 4: 154,090,699 (GRCm39) T884K probably benign Het
Cmbl T C 15: 31,582,215 (GRCm39) Y71H probably damaging Het
Crybg3 A T 16: 59,380,356 (GRCm39) probably benign Het
Dynlt1c T C 17: 6,869,210 (GRCm39) M1T probably null Het
Erbb2 T C 11: 98,319,032 (GRCm39) S574P probably benign Het
Exosc10 T C 4: 148,646,849 (GRCm39) V153A probably benign Het
Faxc G T 4: 21,931,557 (GRCm39) probably benign Het
Fcgbp A G 7: 27,791,243 (GRCm39) T835A probably damaging Het
Fmo5 G T 3: 97,549,076 (GRCm39) M241I probably benign Het
Gabra1 A C 11: 42,024,379 (GRCm39) I432S probably benign Het
Gfap A G 11: 102,786,574 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm12185 T A 11: 48,806,382 (GRCm39) M270L probably benign Het
Gm14443 T C 2: 175,011,372 (GRCm39) N358S possibly damaging Het
Gpr3 C T 4: 132,938,490 (GRCm39) V61M probably damaging Het
Herc2 C T 7: 55,834,709 (GRCm39) T3229M probably damaging Het
Ifit3 A G 19: 34,565,207 (GRCm39) Y251C probably damaging Het
Inf2 G A 12: 112,567,987 (GRCm39) V180I probably benign Het
Ints11 T C 4: 155,959,665 (GRCm39) Y91H probably damaging Het
Ints4 A C 7: 97,158,885 (GRCm39) D419A probably damaging Het
Kmt2e T C 5: 23,704,331 (GRCm39) S1175P probably damaging Het
Mki67 A T 7: 135,315,730 (GRCm39) V44E probably damaging Het
Mrgprb13 A T 7: 47,961,940 (GRCm39) noncoding transcript Het
Myh2 T C 11: 67,077,382 (GRCm39) L839P probably damaging Het
Nos1ap T A 1: 170,176,968 (GRCm39) K145M probably damaging Het
Or4l1 A G 14: 50,167,007 (GRCm39) probably benign Het
Pced1a T A 2: 130,261,091 (GRCm39) H422L probably benign Het
Plpp1 G T 13: 112,988,089 (GRCm39) probably null Het
Plxna4 T C 6: 32,183,056 (GRCm39) Y949C probably damaging Het
Polg2 G A 11: 106,669,796 (GRCm39) T158I probably damaging Het
Prss38 A T 11: 59,263,821 (GRCm39) I297K probably benign Het
Psph A G 5: 129,846,431 (GRCm39) L98P probably damaging Het
Rab11b G A 17: 33,979,243 (GRCm39) probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,229,136 (GRCm39) probably benign Het
Serpine3 G A 14: 62,908,382 (GRCm39) A137T probably damaging Het
Sh3bp4 T C 1: 89,071,997 (GRCm39) F282L probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Skic3 G A 13: 76,295,886 (GRCm39) E1050K possibly damaging Het
Slco2b1 T A 7: 99,338,198 (GRCm39) Y109F possibly damaging Het
Slfn10-ps T A 11: 82,926,355 (GRCm39) noncoding transcript Het
Smc5 A G 19: 23,237,009 (GRCm39) probably null Het
Smyd4 A G 11: 75,292,984 (GRCm39) N638S probably benign Het
Stxbp5 T C 10: 9,675,735 (GRCm39) E628G probably damaging Het
Tmem236 A T 2: 14,223,975 (GRCm39) K255* probably null Het
Ttc29 T A 8: 78,978,539 (GRCm39) probably null Het
Tyr A G 7: 87,087,222 (GRCm39) I430T probably damaging Het
Uckl1 A G 2: 181,216,160 (GRCm39) probably null Het
Vmn2r52 A C 7: 9,904,672 (GRCm39) I389R possibly damaging Het
Wdr62 A T 7: 29,964,688 (GRCm39) F352Y possibly damaging Het
Wdr70 T C 15: 7,953,754 (GRCm39) D379G probably benign Het
Zfp408 T A 2: 91,476,690 (GRCm39) M155L probably benign Het
Zfp459 T A 13: 67,561,249 (GRCm39) Q66H probably damaging Het
Zfp870 C A 17: 33,102,627 (GRCm39) G234V probably damaging Het
Other mutations in Or6c70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Or6c70 APN 10 129,709,900 (GRCm39) missense probably damaging 1.00
IGL02045:Or6c70 APN 10 129,710,091 (GRCm39) missense probably benign 0.22
IGL02301:Or6c70 APN 10 129,709,948 (GRCm39) missense probably damaging 0.99
R0277:Or6c70 UTSW 10 129,709,936 (GRCm39) missense probably damaging 0.99
R0281:Or6c70 UTSW 10 129,710,415 (GRCm39) missense possibly damaging 0.88
R0323:Or6c70 UTSW 10 129,709,936 (GRCm39) missense probably damaging 0.99
R0394:Or6c70 UTSW 10 129,709,811 (GRCm39) missense probably benign 0.29
R0546:Or6c70 UTSW 10 129,710,407 (GRCm39) missense possibly damaging 0.94
R3813:Or6c70 UTSW 10 129,709,855 (GRCm39) missense probably damaging 1.00
R4086:Or6c70 UTSW 10 129,710,167 (GRCm39) missense possibly damaging 0.49
R4415:Or6c70 UTSW 10 129,709,826 (GRCm39) missense probably benign 0.00
R4416:Or6c70 UTSW 10 129,709,826 (GRCm39) missense probably benign 0.00
R4453:Or6c70 UTSW 10 129,710,530 (GRCm39) missense probably null 0.30
R5194:Or6c70 UTSW 10 129,709,967 (GRCm39) missense probably benign 0.00
R5362:Or6c70 UTSW 10 129,710,422 (GRCm39) missense probably damaging 1.00
R5609:Or6c70 UTSW 10 129,710,607 (GRCm39) missense probably benign 0.01
R5987:Or6c70 UTSW 10 129,710,390 (GRCm39) missense probably damaging 0.98
R6240:Or6c70 UTSW 10 129,710,546 (GRCm39) missense probably benign
R6896:Or6c70 UTSW 10 129,710,623 (GRCm39) start codon destroyed probably null 0.98
R7432:Or6c70 UTSW 10 129,709,719 (GRCm39) missense probably benign
R7489:Or6c70 UTSW 10 129,710,551 (GRCm39) missense probably damaging 1.00
R7652:Or6c70 UTSW 10 129,710,346 (GRCm39) missense probably damaging 0.99
R8316:Or6c70 UTSW 10 129,709,891 (GRCm39) missense probably damaging 1.00
R8725:Or6c70 UTSW 10 129,710,092 (GRCm39) missense probably damaging 1.00
R8727:Or6c70 UTSW 10 129,710,092 (GRCm39) missense probably damaging 1.00
R9089:Or6c70 UTSW 10 129,710,488 (GRCm39) missense probably damaging 1.00
R9538:Or6c70 UTSW 10 129,709,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTTCCTGGAGTACTTTTAGCCTG -3'
(R):5'- GATGGCTTTCATCTTAGCTCTCATG -3'

Sequencing Primer
(F):5'- GGAGTACTTTTAGCCTGTTTAATACC -3'
(R):5'- ATCTTAGCTCTCATGACACTCATTG -3'
Posted On 2016-07-22