Mutagenetix > Incidental Mutation

Incidental Mutation 'R5306:Slfn10-ps'

404578

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

042889-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R5306 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83028130-83040042 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 83035529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Meta Mutation Damage Score

0.3221

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (64/66)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	G	19: 29,729,830		probably benign	Het
Adam29	T	A	8: 55,871,757	D554V	probably damaging	Het
Ankrd44	G	A	1: 54,926,203		probably benign	Het
Api5	A	T	2: 94,423,466	C297*	probably null	Het
Asb14	G	A	14: 26,911,909	C357Y	probably damaging	Het
Brdt	T	A	5: 107,345,144	D112E	probably damaging	Het
Capsl	C	A	15: 9,457,790	Q32K	probably benign	Het
Ccdc106	A	G	7: 5,058,097	D81G	probably damaging	Het
Cep104	C	A	4: 154,006,242	T884K	probably benign	Het
Cmbl	T	C	15: 31,582,069	Y71H	probably damaging	Het
Crybg3	A	T	16: 59,559,993		probably benign	Het
Dynlt1c	T	C	17: 6,601,811	M1T	probably null	Het
Erbb2	T	C	11: 98,428,206	S574P	probably benign	Het
Exosc10	T	C	4: 148,562,392	V153A	probably benign	Het
Faxc	G	T	4: 21,931,557		probably benign	Het
Fcgbp	A	G	7: 28,091,818	T835A	probably damaging	Het
Fmo5	G	T	3: 97,641,760	M241I	probably benign	Het
Gabra1	A	C	11: 42,133,552	I432S	probably benign	Het
Gfap	A	G	11: 102,895,748		probably null	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm12185	T	A	11: 48,915,555	M270L	probably benign	Het
Gm14443	T	C	2: 175,169,579	N358S	possibly damaging	Het
Gm6583	T	C	5: 112,355,044	R265G	probably benign	Het
Gpr3	C	T	4: 133,211,179	V61M	probably damaging	Het
Herc2	C	T	7: 56,184,961	T3229M	probably damaging	Het
Ifit3	A	G	19: 34,587,807	Y251C	probably damaging	Het
Inf2	G	A	12: 112,601,553	V180I	probably benign	Het
Ints11	T	C	4: 155,875,208	Y91H	probably damaging	Het
Ints4	A	C	7: 97,509,678	D419A	probably damaging	Het
Kmt2e	T	C	5: 23,499,333	S1175P	probably damaging	Het
Mki67	A	T	7: 135,714,001	V44E	probably damaging	Het
Mrgprb13	A	T	7: 48,312,192		noncoding transcript	Het
Myh2	T	C	11: 67,186,556	L839P	probably damaging	Het
Nos1ap	T	A	1: 170,349,399	K145M	probably damaging	Het
Olfr723	A	G	14: 49,929,550		probably benign	Het
Olfr814	A	C	10: 129,873,941	I272R	probably damaging	Het
Pced1a	T	A	2: 130,419,171	H422L	probably benign	Het
Plpp1	G	T	13: 112,851,555		probably null	Het
Plxna4	T	C	6: 32,206,121	Y949C	probably damaging	Het
Polg2	G	A	11: 106,778,970	T158I	probably damaging	Het
Prss38	A	T	11: 59,372,995	I297K	probably benign	Het
Psph	A	G	5: 129,769,367	L98P	probably damaging	Het
Rab11b	G	A	17: 33,760,269		probably benign	Het
Rsf1	CGGCGGC	CGGCGGCGGGGGCGGC	7: 97,579,929		probably benign	Het
Serpine3	G	A	14: 62,670,933	A137T	probably damaging	Het
Sh3bp4	T	C	1: 89,144,275	F282L	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slco2b1	T	A	7: 99,688,991	Y109F	possibly damaging	Het
Smc5	A	G	19: 23,259,645		probably null	Het
Smyd4	A	G	11: 75,402,158	N638S	probably benign	Het
Stxbp5	T	C	10: 9,799,991	E628G	probably damaging	Het
Tmem236	A	T	2: 14,219,164	K255*	probably null	Het
Ttc29	T	A	8: 78,251,910		probably null	Het
Ttc37	G	A	13: 76,147,767	E1050K	possibly damaging	Het
Tyr	A	G	7: 87,438,014	I430T	probably damaging	Het
Uckl1	A	G	2: 181,574,367		probably null	Het
Vmn2r52	A	C	7: 10,170,745	I389R	possibly damaging	Het
Wdr62	A	T	7: 30,265,263	F352Y	possibly damaging	Het
Wdr70	T	C	15: 7,924,273	D379G	probably benign	Het
Zfp408	T	A	2: 91,646,345	M155L	probably benign	Het
Zfp459	T	A	13: 67,413,130	Q66H	probably damaging	Het
Zfp870	C	A	17: 32,883,653	G234V	probably damaging	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	83035529	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	83035259	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	83035527	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	83035496	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	83035935	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	83029112	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	83032190	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	83029064	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	83032291	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	83030264	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	83030145	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	83030300	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	83030300	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	83035542	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	83035542	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	83035302	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	83035774	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	83029534	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	83035653	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	83035562	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	83035409	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	83029850	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	83030043	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	83030342	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	83035685	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	83028930	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	83029129	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	83035434	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	83029519	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	83030381	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	83030515	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	83029025	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	83035287	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AACTGGCAACTTGGAGATTGC -3'
(R):5'- TTCAAGGGAAGCATTTGACTTTCTG -3'

Sequencing Primer
(F):5'- GAGATTGCTTCATTTGCCACAG -3'
(R):5'- AGAGATGTGTTAAGTGCAGTCCTAC -3'

Posted On

2016-07-22