Incidental Mutation 'R5306:Slfn10-ps'
ID 404578
Institutional Source Beutler Lab
Gene Symbol Slfn10-ps
Ensembl Gene ENSMUSG00000072621
Gene Name schlafen 10, pseudogene
Synonyms
MMRRC Submission 042889-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5306 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 82919681-82926992 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 82926355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100716
SMART Domains Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AlbA_2 142 278 1.3e-13 PFAM
Pfam:DUF2075 529 697 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152760
SMART Domains Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AAA_4 142 280 1.8e-14 PFAM
Pfam:DUF2075 529 693 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215473
Meta Mutation Damage Score 0.3221 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 56,324,792 (GRCm39) D554V probably damaging Het
Ankrd44 G A 1: 54,965,362 (GRCm39) probably benign Het
Api5 A T 2: 94,253,811 (GRCm39) C297* probably null Het
Asb14 G A 14: 26,633,866 (GRCm39) C357Y probably damaging Het
Brd10 A G 19: 29,707,230 (GRCm39) probably benign Het
Brdt T A 5: 107,493,010 (GRCm39) D112E probably damaging Het
Capsl C A 15: 9,457,876 (GRCm39) Q32K probably benign Het
Ccdc106 A G 7: 5,061,096 (GRCm39) D81G probably damaging Het
Ccdc121rt3 T C 5: 112,502,910 (GRCm39) R265G probably benign Het
Cep104 C A 4: 154,090,699 (GRCm39) T884K probably benign Het
Cmbl T C 15: 31,582,215 (GRCm39) Y71H probably damaging Het
Crybg3 A T 16: 59,380,356 (GRCm39) probably benign Het
Dynlt1c T C 17: 6,869,210 (GRCm39) M1T probably null Het
Erbb2 T C 11: 98,319,032 (GRCm39) S574P probably benign Het
Exosc10 T C 4: 148,646,849 (GRCm39) V153A probably benign Het
Faxc G T 4: 21,931,557 (GRCm39) probably benign Het
Fcgbp A G 7: 27,791,243 (GRCm39) T835A probably damaging Het
Fmo5 G T 3: 97,549,076 (GRCm39) M241I probably benign Het
Gabra1 A C 11: 42,024,379 (GRCm39) I432S probably benign Het
Gfap A G 11: 102,786,574 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gm12185 T A 11: 48,806,382 (GRCm39) M270L probably benign Het
Gm14443 T C 2: 175,011,372 (GRCm39) N358S possibly damaging Het
Gpr3 C T 4: 132,938,490 (GRCm39) V61M probably damaging Het
Herc2 C T 7: 55,834,709 (GRCm39) T3229M probably damaging Het
Ifit3 A G 19: 34,565,207 (GRCm39) Y251C probably damaging Het
Inf2 G A 12: 112,567,987 (GRCm39) V180I probably benign Het
Ints11 T C 4: 155,959,665 (GRCm39) Y91H probably damaging Het
Ints4 A C 7: 97,158,885 (GRCm39) D419A probably damaging Het
Kmt2e T C 5: 23,704,331 (GRCm39) S1175P probably damaging Het
Mki67 A T 7: 135,315,730 (GRCm39) V44E probably damaging Het
Mrgprb13 A T 7: 47,961,940 (GRCm39) noncoding transcript Het
Myh2 T C 11: 67,077,382 (GRCm39) L839P probably damaging Het
Nos1ap T A 1: 170,176,968 (GRCm39) K145M probably damaging Het
Or4l1 A G 14: 50,167,007 (GRCm39) probably benign Het
Or6c70 A C 10: 129,709,810 (GRCm39) I272R probably damaging Het
Pced1a T A 2: 130,261,091 (GRCm39) H422L probably benign Het
Plpp1 G T 13: 112,988,089 (GRCm39) probably null Het
Plxna4 T C 6: 32,183,056 (GRCm39) Y949C probably damaging Het
Polg2 G A 11: 106,669,796 (GRCm39) T158I probably damaging Het
Prss38 A T 11: 59,263,821 (GRCm39) I297K probably benign Het
Psph A G 5: 129,846,431 (GRCm39) L98P probably damaging Het
Rab11b G A 17: 33,979,243 (GRCm39) probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,229,136 (GRCm39) probably benign Het
Serpine3 G A 14: 62,908,382 (GRCm39) A137T probably damaging Het
Sh3bp4 T C 1: 89,071,997 (GRCm39) F282L probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Skic3 G A 13: 76,295,886 (GRCm39) E1050K possibly damaging Het
Slco2b1 T A 7: 99,338,198 (GRCm39) Y109F possibly damaging Het
Smc5 A G 19: 23,237,009 (GRCm39) probably null Het
Smyd4 A G 11: 75,292,984 (GRCm39) N638S probably benign Het
Stxbp5 T C 10: 9,675,735 (GRCm39) E628G probably damaging Het
Tmem236 A T 2: 14,223,975 (GRCm39) K255* probably null Het
Ttc29 T A 8: 78,978,539 (GRCm39) probably null Het
Tyr A G 7: 87,087,222 (GRCm39) I430T probably damaging Het
Uckl1 A G 2: 181,216,160 (GRCm39) probably null Het
Vmn2r52 A C 7: 9,904,672 (GRCm39) I389R possibly damaging Het
Wdr62 A T 7: 29,964,688 (GRCm39) F352Y possibly damaging Het
Wdr70 T C 15: 7,953,754 (GRCm39) D379G probably benign Het
Zfp408 T A 2: 91,476,690 (GRCm39) M155L probably benign Het
Zfp459 T A 13: 67,561,249 (GRCm39) Q66H probably damaging Het
Zfp870 C A 17: 33,102,627 (GRCm39) G234V probably damaging Het
Other mutations in Slfn10-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slfn10-ps APN 11 82,926,355 (GRCm39) unclassified noncoding transcript
IGL00826:Slfn10-ps APN 11 82,926,085 (GRCm39) unclassified noncoding transcript
IGL01022:Slfn10-ps APN 11 82,926,353 (GRCm39) unclassified noncoding transcript
IGL01409:Slfn10-ps APN 11 82,926,322 (GRCm39) unclassified noncoding transcript
IGL01664:Slfn10-ps APN 11 82,926,761 (GRCm39) unclassified noncoding transcript
IGL01700:Slfn10-ps APN 11 82,919,938 (GRCm39) unclassified noncoding transcript
IGL02093:Slfn10-ps APN 11 82,923,016 (GRCm39) unclassified noncoding transcript
IGL02253:Slfn10-ps APN 11 82,919,890 (GRCm39) unclassified noncoding transcript
IGL02364:Slfn10-ps APN 11 82,923,117 (GRCm39) unclassified noncoding transcript
IGL02466:Slfn10-ps APN 11 82,921,090 (GRCm39) unclassified noncoding transcript
IGL02636:Slfn10-ps APN 11 82,920,971 (GRCm39) unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 82,921,126 (GRCm39) unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 82,921,126 (GRCm39) unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 82,926,368 (GRCm39) unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 82,926,368 (GRCm39) unclassified noncoding transcript
R0164:Slfn10-ps UTSW 11 82,926,128 (GRCm39) unclassified noncoding transcript
R0362:Slfn10-ps UTSW 11 82,926,600 (GRCm39) unclassified noncoding transcript
R0382:Slfn10-ps UTSW 11 82,920,360 (GRCm39) unclassified noncoding transcript
R0597:Slfn10-ps UTSW 11 82,926,479 (GRCm39) unclassified noncoding transcript
R0812:Slfn10-ps UTSW 11 82,926,388 (GRCm39) unclassified noncoding transcript
R0904:Slfn10-ps UTSW 11 82,926,235 (GRCm39) unclassified noncoding transcript
R1552:Slfn10-ps UTSW 11 82,920,676 (GRCm39) unclassified noncoding transcript
R1703:Slfn10-ps UTSW 11 82,920,869 (GRCm39) unclassified noncoding transcript
R2127:Slfn10-ps UTSW 11 82,921,168 (GRCm39) unclassified noncoding transcript
R2151:Slfn10-ps UTSW 11 82,926,511 (GRCm39) unclassified noncoding transcript
R2302:Slfn10-ps UTSW 11 82,919,756 (GRCm39) unclassified noncoding transcript
R3114:Slfn10-ps UTSW 11 82,919,955 (GRCm39) unclassified noncoding transcript
R4293:Slfn10-ps UTSW 11 82,926,260 (GRCm39) unclassified noncoding transcript
R4929:Slfn10-ps UTSW 11 82,920,345 (GRCm39) unclassified noncoding transcript
R4970:Slfn10-ps UTSW 11 82,921,207 (GRCm39) unclassified noncoding transcript
R5083:Slfn10-ps UTSW 11 82,921,341 (GRCm39) unclassified noncoding transcript
R5290:Slfn10-ps UTSW 11 82,919,851 (GRCm39) unclassified noncoding transcript
R5444:Slfn10-ps UTSW 11 82,926,113 (GRCm39) unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- AACTGGCAACTTGGAGATTGC -3'
(R):5'- TTCAAGGGAAGCATTTGACTTTCTG -3'

Sequencing Primer
(F):5'- GAGATTGCTTCATTTGCCACAG -3'
(R):5'- AGAGATGTGTTAAGTGCAGTCCTAC -3'
Posted On 2016-07-22