Incidental Mutation 'R5306:Ttc37'
ID 404585
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Name tetratricopeptide repeat domain 37
Synonyms
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock # R5306 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 76098734-76190316 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76147767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1050 (E1050K)
Ref Sequence ENSEMBL: ENSMUSP00000153521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
AlphaFold F8VPK0
Predicted Effect possibly damaging
Transcript: ENSMUST00000091466
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: E1050K

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224289
Predicted Effect possibly damaging
Transcript: ENSMUST00000224386
AA Change: E1050K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 splice site probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
R7348:Ttc37 UTSW 13 76182884 missense possibly damaging 0.82
R7384:Ttc37 UTSW 13 76150735 missense possibly damaging 0.53
R7404:Ttc37 UTSW 13 76148747 nonsense probably null
R7421:Ttc37 UTSW 13 76148825 missense probably benign 0.12
R7546:Ttc37 UTSW 13 76134835 missense probably damaging 1.00
R7771:Ttc37 UTSW 13 76135030 missense probably benign 0.21
R7960:Ttc37 UTSW 13 76112199 missense probably benign 0.03
R8125:Ttc37 UTSW 13 76130327 critical splice donor site probably null
R8136:Ttc37 UTSW 13 76113103 missense probably benign 0.00
R8680:Ttc37 UTSW 13 76155468 missense probably benign 0.01
R8697:Ttc37 UTSW 13 76180155 missense probably damaging 1.00
R8867:Ttc37 UTSW 13 76131309 missense probably damaging 0.99
R8872:Ttc37 UTSW 13 76185207 missense probably damaging 1.00
R8876:Ttc37 UTSW 13 76175284 missense probably benign 0.12
R8912:Ttc37 UTSW 13 76157242 splice site probably benign
R9174:Ttc37 UTSW 13 76147774 missense probably benign 0.00
R9334:Ttc37 UTSW 13 76132957 missense possibly damaging 0.65
R9389:Ttc37 UTSW 13 76127039 missense probably benign 0.02
R9443:Ttc37 UTSW 13 76118169 missense probably benign 0.01
R9545:Ttc37 UTSW 13 76111713 missense probably damaging 1.00
R9596:Ttc37 UTSW 13 76182849 missense possibly damaging 0.64
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAGGTGCAGTCAGATCCTC -3'
(R):5'- TTTTAGTAAACACTGCAACCCC -3'

Sequencing Primer
(F):5'- AGGTGCAGTCAGATCCTCTCTATG -3'
(R):5'- CTAGAGGATCAAGGTTCAATTCCCAG -3'
Posted On 2016-07-22