Incidental Mutation 'R5306:Smc5'
ID404599
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5306 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 23259645 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556] [ENSMUST00000087556] [ENSMUST00000223934] [ENSMUST00000223934] [ENSMUST00000226111] [ENSMUST00000226111]
Predicted Effect probably null
Transcript: ENSMUST00000087556
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087556
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000223934
Predicted Effect probably null
Transcript: ENSMUST00000223934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224723
Predicted Effect probably null
Transcript: ENSMUST00000226111
Predicted Effect probably null
Transcript: ENSMUST00000226111
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Ifit3 A G 19: 34,587,807 Y251C probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7002:Smc5 UTSW 19 23231883 missense probably benign 0.00
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7596:Smc5 UTSW 19 23214169 missense probably damaging 0.99
R7666:Smc5 UTSW 19 23229017 missense probably benign 0.15
R7760:Smc5 UTSW 19 23235890 missense probably benign 0.01
R7990:Smc5 UTSW 19 23235882 missense probably benign 0.01
R8255:Smc5 UTSW 19 23208926 missense
R8359:Smc5 UTSW 19 23234079 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCCTAGACATACTTTGTAGGTACTCAG -3'
(R):5'- AAGATTTGACTTGCCGTGTTC -3'

Sequencing Primer
(F):5'- GAGAAAATGCCTCCTTTAGACTGGC -3'
(R):5'- TGCCGTGTTCTTATTTTCATTTAAAC -3'
Posted On2016-07-22