Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Igfn1'

404602

Institutional Source

Beutler Lab

Gene Symbol

Igfn1

Ensembl Gene

ENSMUSG00000051985

Gene Name

immunoglobulin-like and fibronectin type III domain containing 1

Synonyms

9830123M21Rik

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135953578-136006342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135964938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2148 (V2148E)

Ref Sequence

ENSEMBL: ENSMUSP00000129680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166193]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000124134
AA Change: V532E

SMART Domains

Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: V532E

Domain	Start	End	E-Value	Type
IG	73	159	1.29e-6	SMART
IG_like	258	344	5.45e1	SMART
IG	354	435	1.79e0	SMART
IG	445	524	3.54e-4	SMART
IG	538	624	4.86e-2	SMART
FN3	627	711	3.99e-10	SMART
FN3	727	810	9.1e-14	SMART
FN3	828	911	1.5e-14	SMART
IG	938	1021	6.41e-2	SMART
FN3	1024	1106	3.2e-9	SMART
IGc2	1152	1219	4.89e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140703

Predicted Effect

probably damaging
Transcript: ENSMUST00000166193
AA Change: V2148E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: V2148E

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
IG	193	279	1.29e-6	SMART
PDB:2LHU\|A	302	365	8e-7	PDB
IG_like	378	464	5.45e1	SMART
IG	474	555	1.79e0	SMART
low complexity region	724	739	N/A	INTRINSIC
internal_repeat_2	838	1006	9.98e-5	PROSPERO
low complexity region	1067	1084	N/A	INTRINSIC
internal_repeat_2	1812	1967	9.98e-5	PROSPERO
Pfam:I-set	2054	2139	6.2e-8	PFAM
IG	2153	2239	4.86e-2	SMART
FN3	2242	2326	3.99e-10	SMART
FN3	2342	2425	9.1e-14	SMART
FN3	2443	2526	1.5e-14	SMART
IG	2553	2636	6.41e-2	SMART
FN3	2639	2721	3.2e-9	SMART
IGc2	2767	2834	4.89e-7	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Igfn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Igfn1	APN	1	135966726	missense	probably damaging	1.00
IGL02299:Igfn1	APN	1	135954017	utr 3 prime	probably benign
Bounty	UTSW	1	135976917	critical splice donor site	probably null
R2276_Igfn1_773	UTSW	1	135964741	missense	probably damaging	0.98
R4058_Igfn1_315	UTSW	1	135969756	missense	probably benign	0.07
R0144:Igfn1	UTSW	1	135962013	missense	probably damaging	0.99
R0190:Igfn1	UTSW	1	135962052	missense	probably damaging	1.00
R0350:Igfn1	UTSW	1	135956767	nonsense	probably null
R0413:Igfn1	UTSW	1	135967596	missense	probably benign	0.23
R0504:Igfn1	UTSW	1	135968529	missense	probably benign	0.00
R0606:Igfn1	UTSW	1	135959901	missense	probably damaging	1.00
R0681:Igfn1	UTSW	1	135963853	missense	possibly damaging	0.88
R0825:Igfn1	UTSW	1	135963126	missense	probably damaging	1.00
R0839:Igfn1	UTSW	1	135954680	missense	probably damaging	1.00
R1066:Igfn1	UTSW	1	135970725	missense	probably benign
R1078:Igfn1	UTSW	1	135974847	missense	probably damaging	1.00
R1224:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R1569:Igfn1	UTSW	1	135969033	missense	probably benign
R1626:Igfn1	UTSW	1	135968967	missense	probably benign	0.29
R1663:Igfn1	UTSW	1	135968308	missense	probably benign	0.15
R1677:Igfn1	UTSW	1	135971101	missense	probably damaging	0.99
R1709:Igfn1	UTSW	1	135955573	missense	probably benign	0.24
R1728:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1728:Igfn1	UTSW	1	135968199	missense	probably benign
R1728:Igfn1	UTSW	1	135970411	missense	probably benign
R1728:Igfn1	UTSW	1	135972127	missense	probably benign
R1728:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1728:Igfn1	UTSW	1	135982475	missense	probably benign
R1728:Igfn1	UTSW	1	135998625	missense	probably benign
R1728:Igfn1	UTSW	1	135998683	missense	unknown
R1729:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1729:Igfn1	UTSW	1	135968199	missense	probably benign
R1729:Igfn1	UTSW	1	135970411	missense	probably benign
R1729:Igfn1	UTSW	1	135972127	missense	probably benign
R1729:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1729:Igfn1	UTSW	1	135982475	missense	probably benign
R1729:Igfn1	UTSW	1	135998625	missense	probably benign
R1729:Igfn1	UTSW	1	135998683	missense	unknown
R1730:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1730:Igfn1	UTSW	1	135968199	missense	probably benign
R1730:Igfn1	UTSW	1	135970411	missense	probably benign
R1730:Igfn1	UTSW	1	135972127	missense	probably benign
R1730:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1730:Igfn1	UTSW	1	135982475	missense	probably benign
R1730:Igfn1	UTSW	1	135998625	missense	probably benign
R1730:Igfn1	UTSW	1	135998683	missense	unknown
R1739:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1739:Igfn1	UTSW	1	135968199	missense	probably benign
R1739:Igfn1	UTSW	1	135970411	missense	probably benign
R1739:Igfn1	UTSW	1	135972127	missense	probably benign
R1739:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1739:Igfn1	UTSW	1	135982475	missense	probably benign
R1739:Igfn1	UTSW	1	135998625	missense	probably benign
R1739:Igfn1	UTSW	1	135998683	missense	unknown
R1746:Igfn1	UTSW	1	135969823	missense	possibly damaging	0.88
R1762:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1762:Igfn1	UTSW	1	135968199	missense	probably benign
R1762:Igfn1	UTSW	1	135970411	missense	probably benign
R1762:Igfn1	UTSW	1	135972127	missense	probably benign
R1762:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1762:Igfn1	UTSW	1	135982475	missense	probably benign
R1762:Igfn1	UTSW	1	135998625	missense	probably benign
R1762:Igfn1	UTSW	1	135998683	missense	unknown
R1783:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1783:Igfn1	UTSW	1	135968199	missense	probably benign
R1783:Igfn1	UTSW	1	135970411	missense	probably benign
R1783:Igfn1	UTSW	1	135972127	missense	probably benign
R1783:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1783:Igfn1	UTSW	1	135982475	missense	probably benign
R1783:Igfn1	UTSW	1	135998625	missense	probably benign
R1783:Igfn1	UTSW	1	135998683	missense	unknown
R1784:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1784:Igfn1	UTSW	1	135968199	missense	probably benign
R1784:Igfn1	UTSW	1	135970411	missense	probably benign
R1784:Igfn1	UTSW	1	135972127	missense	probably benign
R1784:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1784:Igfn1	UTSW	1	135982475	missense	probably benign
R1784:Igfn1	UTSW	1	135998625	missense	probably benign
R1784:Igfn1	UTSW	1	135998683	missense	unknown
R1785:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1785:Igfn1	UTSW	1	135968199	missense	probably benign
R1785:Igfn1	UTSW	1	135970411	missense	probably benign
R1785:Igfn1	UTSW	1	135972127	missense	probably benign
R1785:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1785:Igfn1	UTSW	1	135982475	missense	probably benign
R1785:Igfn1	UTSW	1	135998625	missense	probably benign
R1785:Igfn1	UTSW	1	135998683	missense	unknown
R1847:Igfn1	UTSW	1	135969388	missense	probably benign
R1866:Igfn1	UTSW	1	135974868	splice site	probably null
R1921:Igfn1	UTSW	1	135966063	critical splice donor site	probably null
R1984:Igfn1	UTSW	1	135962044	missense	probably benign	0.39
R2049:Igfn1	UTSW	1	135970638	missense	probably benign
R2049:Igfn1	UTSW	1	135974852	splice site	probably benign
R2098:Igfn1	UTSW	1	135978305	missense	probably damaging	1.00
R2130:Igfn1	UTSW	1	135974852	splice site	probably benign
R2141:Igfn1	UTSW	1	135974852	splice site	probably benign
R2276:Igfn1	UTSW	1	135964741	missense	probably damaging	0.98
R2425:Igfn1	UTSW	1	135963102	missense	probably damaging	1.00
R2483:Igfn1	UTSW	1	135969537	missense	probably benign
R2504:Igfn1	UTSW	1	135969316	missense	probably benign	0.07
R3109:Igfn1	UTSW	1	135997848	missense	probably benign	0.12
R3421:Igfn1	UTSW	1	135976917	critical splice donor site	probably null
R3423:Igfn1	UTSW	1	135998641	missense	probably benign	0.01
R3705:Igfn1	UTSW	1	135968409	missense	probably benign
R3871:Igfn1	UTSW	1	135968836	missense	probably benign	0.03
R3875:Igfn1	UTSW	1	135954614	missense	probably damaging	1.00
R3953:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3955:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3957:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3965:Igfn1	UTSW	1	135967819	missense	probably benign
R4006:Igfn1	UTSW	1	135982362	splice site	probably null
R4058:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4059:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4370:Igfn1	UTSW	1	135968106	missense	probably benign	0.00
R4380:Igfn1	UTSW	1	135967771	missense	probably benign	0.00
R4495:Igfn1	UTSW	1	135969678	missense	possibly damaging	0.79
R4628:Igfn1	UTSW	1	135959730	missense	possibly damaging	0.47
R4672:Igfn1	UTSW	1	135965369	missense	possibly damaging	0.72
R4682:Igfn1	UTSW	1	135998625	missense	probably benign
R4702:Igfn1	UTSW	1	135967209	missense	possibly damaging	0.71
R4744:Igfn1	UTSW	1	135982458	missense	probably benign	0.07
R4777:Igfn1	UTSW	1	135954862	missense	probably benign
R4806:Igfn1	UTSW	1	135967357	missense	probably benign	0.01
R4840:Igfn1	UTSW	1	135968040	missense	probably benign	0.00
R4894:Igfn1	UTSW	1	135954782	missense	probably damaging	1.00
R4998:Igfn1	UTSW	1	135954666	missense	probably damaging	1.00
R5092:Igfn1	UTSW	1	135964826	missense	probably benign
R5108:Igfn1	UTSW	1	135982441	missense	probably benign
R5120:Igfn1	UTSW	1	135973502	missense	possibly damaging	0.93
R5127:Igfn1	UTSW	1	135959896	missense	probably damaging	1.00
R5231:Igfn1	UTSW	1	135966736	missense	probably benign	0.26
R5286:Igfn1	UTSW	1	135967861	missense	probably benign	0.10
R5380:Igfn1	UTSW	1	135966087	missense	probably damaging	1.00
R5553:Igfn1	UTSW	1	135967884	missense	probably damaging	1.00
R5660:Igfn1	UTSW	1	135970414	missense	probably benign	0.01
R5779:Igfn1	UTSW	1	135966840	missense	probably benign	0.16
R5818:Igfn1	UTSW	1	135966126	missense	possibly damaging	0.72
R5832:Igfn1	UTSW	1	135974795	missense	probably damaging	0.96
R5933:Igfn1	UTSW	1	135970603	nonsense	probably null
R5966:Igfn1	UTSW	1	135965414	missense	probably damaging	1.00
R6116:Igfn1	UTSW	1	135970467	missense	probably benign	0.00
R6297:Igfn1	UTSW	1	135964661	critical splice donor site	probably null
R6652:Igfn1	UTSW	1	135963871	missense	probably damaging	1.00
R6737:Igfn1	UTSW	1	135969867	missense	probably benign
R6816:Igfn1	UTSW	1	135959728	missense	probably benign	0.02
R6886:Igfn1	UTSW	1	135973460	missense	probably damaging	1.00
R6888:Igfn1	UTSW	1	135982480	missense	probably benign	0.33
R6975:Igfn1	UTSW	1	135968445	missense	probably damaging	0.96
R7105:Igfn1	UTSW	1	135984218	missense	probably benign	0.11
R7114:Igfn1	UTSW	1	135966781	missense	probably benign	0.01
R7233:Igfn1	UTSW	1	135970135	missense	probably benign	0.41
R7276:Igfn1	UTSW	1	135998638	missense	possibly damaging	0.85
R7354:Igfn1	UTSW	1	135976032	missense	possibly damaging	0.72
R7358:Igfn1	UTSW	1	135964000	missense	probably damaging	1.00
R7380:Igfn1	UTSW	1	135962008	missense	probably damaging	1.00
R7389:Igfn1	UTSW	1	135967047	missense	probably benign	0.00
R7513:Igfn1	UTSW	1	135959967	missense	probably damaging	1.00
R7718:Igfn1	UTSW	1	135969036	missense	probably benign
R7769:Igfn1	UTSW	1	135982405	missense	possibly damaging	0.85
R7810:Igfn1	UTSW	1	135974789	missense	probably damaging	0.98
R7917:Igfn1	UTSW	1	135971968	missense	probably damaging	0.99
R7952:Igfn1	UTSW	1	135963955	missense	probably damaging	0.99
R8041:Igfn1	UTSW	1	135968059	nonsense	probably null
R8233:Igfn1	UTSW	1	135968044	missense	probably benign	0.00
R8354:Igfn1	UTSW	1	135959881	missense	possibly damaging	0.61
R8363:Igfn1	UTSW	1	135963887	missense	probably benign	0.01
R8428:Igfn1	UTSW	1	135967782	missense	probably damaging	1.00
R8731:Igfn1	UTSW	1	135997836	missense	probably benign	0.02
R8756:Igfn1	UTSW	1	135967960	missense	probably benign	0.10
R8797:Igfn1	UTSW	1	135974835	missense	possibly damaging	0.93
R8913:Igfn1	UTSW	1	135963841	missense	possibly damaging	0.90
R8927:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R8928:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R9087:Igfn1	UTSW	1	135974868	splice site	probably null
R9109:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9113:Igfn1	UTSW	1	135955590	missense	probably damaging	1.00
R9117:Igfn1	UTSW	1	135974790	missense	probably benign	0.03
R9205:Igfn1	UTSW	1	135975957	missense	probably damaging	0.96
R9251:Igfn1	UTSW	1	135966671	splice site	probably benign
R9260:Igfn1	UTSW	1	135979956	missense	probably benign	0.45
R9275:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9277:Igfn1	UTSW	1	135959782	missense	probably damaging	0.98
R9278:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9287:Igfn1	UTSW	1	135997806	missense	probably benign	0.33
R9298:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9356:Igfn1	UTSW	1	135972087	nonsense	probably null
R9371:Igfn1	UTSW	1	135978263	missense	probably damaging	1.00
R9532:Igfn1	UTSW	1	135969491	missense	possibly damaging	0.61
R9653:Igfn1	UTSW	1	135955585	nonsense	probably null
R9666:Igfn1	UTSW	1	135969954	missense	possibly damaging	0.65
R9741:Igfn1	UTSW	1	135967645	missense	probably benign	0.00
R9748:Igfn1	UTSW	1	135998598	missense	possibly damaging	0.89
R9796:Igfn1	UTSW	1	135969873	missense	probably benign	0.26
Z1176:Igfn1	UTSW	1	135972000	missense	probably damaging	0.99
Z1177:Igfn1	UTSW	1	135955809	missense	probably damaging	1.00
Z1177:Igfn1	UTSW	1	135969567	missense	probably benign	0.26
Z1177:Igfn1	UTSW	1	135982426	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CATGTGTAGCCATCTGCCAGAG -3'
(R):5'- TATGAAGCCAACCCATGCCTTC -3'

Sequencing Primer
(F):5'- ATCTGCCAGAGCCAGTTGGATG -3'
(R):5'- GAACTTGGTCCTCTCTGA -3'

Posted On

2016-07-22