Incidental Mutation 'R5307:Hnrnpu'
ID404604
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Nameheterogeneous nuclear ribonucleoprotein U
SynonymsHnrpu, scaffold attachment factor A, Sp120
MMRRC Submission 042890-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5307 (G1)
Quality Score219
Status Not validated
Chromosome1
Chromosomal Location178321108-178337797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178337312 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 87 (E87G)
Ref Sequence ENSEMBL: ENSMUSP00000124147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: E87G
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: E87G

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150825
Predicted Effect unknown
Transcript: ENSMUST00000161769
AA Change: E87G
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: E87G

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194245
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178330774 unclassified probably benign
R1136:Hnrnpu UTSW 1 178331225 unclassified probably benign
R1205:Hnrnpu UTSW 1 178332169 unclassified probably benign
R1317:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1318:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1778:Hnrnpu UTSW 1 178325241 critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3161:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R4408:Hnrnpu UTSW 1 178330803 unclassified probably benign
R4667:Hnrnpu UTSW 1 178332181 unclassified probably benign
R4833:Hnrnpu UTSW 1 178333894 unclassified probably benign
R4906:Hnrnpu UTSW 1 178329373 intron probably benign
R4923:Hnrnpu UTSW 1 178331452 unclassified probably benign
R5000:Hnrnpu UTSW 1 178329376 intron probably benign
R5256:Hnrnpu UTSW 1 178335893 missense unknown
R5911:Hnrnpu UTSW 1 178330172 unclassified probably benign
R6931:Hnrnpu UTSW 1 178331432 unclassified probably benign
R7061:Hnrnpu UTSW 1 178336126 missense unknown
R7077:Hnrnpu UTSW 1 178332191 missense unknown
R7391:Hnrnpu UTSW 1 178337078 missense unknown
R7423:Hnrnpu UTSW 1 178329284 intron probably benign
R8037:Hnrnpu UTSW 1 178332352 missense unknown
Z1176:Hnrnpu UTSW 1 178332215 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATACATAATGGAGGCGCCG -3'
(R):5'- TCAAGGCCGATCTCATGGATC -3'

Sequencing Primer
(F):5'- ACCACGCTGCTGGGAAG -3'
(R):5'- GATCGACTCCAGGCCGC -3'
Posted On2016-07-22