Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Hnrnpu'

404604

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpu

Ensembl Gene

ENSMUSG00000039630

Gene Name

heterogeneous nuclear ribonucleoprotein U

Synonyms

Hnrpu, scaffold attachment factor A, Sp120

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5307 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

178321108-178337797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 178337312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 87 (E87G)

Ref Sequence

ENSEMBL: ENSMUSP00000124147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]

AlphaFold

Q8VEK3

Predicted Effect

unknown
Transcript: ENSMUST00000037748
AA Change: E87G

SMART Domains

Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: E87G

Domain	Start	End	E-Value	Type
SAP	8	42	3.57e-11	SMART
low complexity region	70	96	N/A	INTRINSIC
low complexity region	101	154	N/A	INTRINSIC
low complexity region	155	171	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
low complexity region	194	207	N/A	INTRINSIC
SPRY	307	439	2.35e-34	SMART
Pfam:AAA_33	475	619	2e-30	PFAM
coiled coil region	626	653	N/A	INTRINSIC
low complexity region	657	675	N/A	INTRINSIC
low complexity region	676	732	N/A	INTRINSIC
low complexity region	736	750	N/A	INTRINSIC
low complexity region	753	791	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146362

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150825

Predicted Effect

unknown
Transcript: ENSMUST00000161769
AA Change: E87G

SMART Domains

Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: E87G

Domain	Start	End	E-Value	Type
SAP	8	42	3.57e-11	SMART
low complexity region	70	96	N/A	INTRINSIC
low complexity region	101	154	N/A	INTRINSIC
low complexity region	155	171	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
low complexity region	194	207	N/A	INTRINSIC
SPRY	307	439	2.35e-34	SMART
Pfam:AAA_33	475	619	6.7e-31	PFAM
coiled coil region	626	653	N/A	INTRINSIC
low complexity region	657	675	N/A	INTRINSIC
low complexity region	676	732	N/A	INTRINSIC
low complexity region	736	750	N/A	INTRINSIC
low complexity region	753	773	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194245

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Hnrnpu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03117:Hnrnpu	APN	1	178330774	unclassified	probably benign
R1136:Hnrnpu	UTSW	1	178331225	unclassified	probably benign
R1205:Hnrnpu	UTSW	1	178332169	unclassified	probably benign
R1317:Hnrnpu	UTSW	1	178330257	unclassified	probably benign
R1318:Hnrnpu	UTSW	1	178330257	unclassified	probably benign
R1778:Hnrnpu	UTSW	1	178325241	critical splice donor site	probably benign
R3160:Hnrnpu	UTSW	1	178331125	unclassified	probably benign
R3161:Hnrnpu	UTSW	1	178331125	unclassified	probably benign
R3162:Hnrnpu	UTSW	1	178331125	unclassified	probably benign
R3162:Hnrnpu	UTSW	1	178331125	unclassified	probably benign
R4408:Hnrnpu	UTSW	1	178330803	unclassified	probably benign
R4667:Hnrnpu	UTSW	1	178332181	unclassified	probably benign
R4833:Hnrnpu	UTSW	1	178333894	unclassified	probably benign
R4906:Hnrnpu	UTSW	1	178329373	intron	probably benign
R4923:Hnrnpu	UTSW	1	178331452	unclassified	probably benign
R5000:Hnrnpu	UTSW	1	178329376	intron	probably benign
R5256:Hnrnpu	UTSW	1	178335893	missense	unknown
R5911:Hnrnpu	UTSW	1	178330172	unclassified	probably benign
R6931:Hnrnpu	UTSW	1	178331432	unclassified	probably benign
R7061:Hnrnpu	UTSW	1	178336126	missense	unknown
R7077:Hnrnpu	UTSW	1	178332191	missense	unknown
R7391:Hnrnpu	UTSW	1	178337078	missense	unknown
R7423:Hnrnpu	UTSW	1	178329284	intron	probably benign
R7991:Hnrnpu	UTSW	1	178332306	missense	unknown
R8037:Hnrnpu	UTSW	1	178332352	missense	unknown
R8161:Hnrnpu	UTSW	1	178337502	missense	possibly damaging	0.95
R8265:Hnrnpu	UTSW	1	178332160	missense	unknown
R8537:Hnrnpu	UTSW	1	178333634	unclassified	probably benign
Z1176:Hnrnpu	UTSW	1	178332215	missense	unknown
Z1186:Hnrnpu	UTSW	1	178337026	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- ACATACATAATGGAGGCGCCG -3'
(R):5'- TCAAGGCCGATCTCATGGATC -3'

Sequencing Primer
(F):5'- ACCACGCTGCTGGGAAG -3'
(R):5'- GATCGACTCCAGGCCGC -3'

Posted On

2016-07-22