Incidental Mutation 'R5307:Or5ar1'
ID 404610
Institutional Source Beutler Lab
Gene Symbol Or5ar1
Ensembl Gene ENSMUSG00000075208
Gene Name olfactory receptor family 5 subfamily AR member 1
Synonyms MOR180-1, Olfr1019, GA_x6K02T2Q125-47320309-47319377
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 85671201-85672133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 85671358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 259 (Y259S)
Ref Sequence ENSEMBL: ENSMUSP00000150622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102634] [ENSMUST00000213515]
AlphaFold Q8VGS3
Predicted Effect probably damaging
Transcript: ENSMUST00000102634
AA Change: Y259S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099694
Gene: ENSMUSG00000075208
AA Change: Y259S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 237 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213515
AA Change: Y259S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Or5ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Or5ar1 APN 2 85,671,706 (GRCm39) missense probably benign 0.02
IGL02734:Or5ar1 APN 2 85,671,883 (GRCm39) missense possibly damaging 0.88
IGL03030:Or5ar1 APN 2 85,671,416 (GRCm39) missense probably damaging 1.00
IGL03207:Or5ar1 APN 2 85,671,317 (GRCm39) missense probably benign 0.14
IGL03215:Or5ar1 APN 2 85,671,725 (GRCm39) missense probably damaging 1.00
IGL03220:Or5ar1 APN 2 85,671,326 (GRCm39) missense possibly damaging 0.87
R0441:Or5ar1 UTSW 2 85,671,859 (GRCm39) missense probably damaging 1.00
R4013:Or5ar1 UTSW 2 85,671,725 (GRCm39) missense probably damaging 1.00
R4604:Or5ar1 UTSW 2 85,671,526 (GRCm39) missense probably damaging 0.99
R5754:Or5ar1 UTSW 2 85,671,656 (GRCm39) missense probably damaging 1.00
R6010:Or5ar1 UTSW 2 85,671,905 (GRCm39) missense probably benign 0.16
R6062:Or5ar1 UTSW 2 85,671,458 (GRCm39) missense probably benign
R6103:Or5ar1 UTSW 2 85,671,776 (GRCm39) missense probably damaging 1.00
R6443:Or5ar1 UTSW 2 85,671,979 (GRCm39) missense probably damaging 0.99
R7442:Or5ar1 UTSW 2 85,672,096 (GRCm39) missense probably benign 0.04
R7490:Or5ar1 UTSW 2 85,671,307 (GRCm39) missense probably damaging 1.00
R7524:Or5ar1 UTSW 2 85,671,701 (GRCm39) missense probably benign
R7605:Or5ar1 UTSW 2 85,671,383 (GRCm39) missense probably benign 0.34
R7615:Or5ar1 UTSW 2 85,672,001 (GRCm39) missense probably benign 0.02
R9706:Or5ar1 UTSW 2 85,671,658 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAACTTGGGTGATACTTTACAC -3'
(R):5'- TGGCTTCATTGAGTTCAGCAC -3'

Sequencing Primer
(F):5'- AGCACTGTCCTTCTGTTACATGAG -3'
(R):5'- TCATTGAGTTCAGCACCATCC -3'
Posted On 2016-07-22