Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Olfr1281'

404611

Institutional Source

Beutler Lab

Gene Symbol

Olfr1281

Ensembl Gene

ENSMUSG00000095156

Gene Name

olfactory receptor 1281

Synonyms

GA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111326520-111332852 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 111328396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000087798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090326] [ENSMUST00000208176] [ENSMUST00000213551]

AlphaFold

Q7TQY6

Predicted Effect

probably null
Transcript: ENSMUST00000090326

SMART Domains

Protein: ENSMUSP00000087798
Gene: ENSMUSG00000095156

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	304	4.8e-48	PFAM
Pfam:7TM_GPCR_Srsx	35	301	2.6e-6	PFAM
Pfam:7tm_1	41	287	4.8e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208176

Predicted Effect

probably benign
Transcript: ENSMUST00000213551

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Olfr1281

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02426:Olfr1281	APN	2	111328575	missense	probably damaging	1.00
IGL02550:Olfr1281	APN	2	111328500	missense	probably damaging	1.00
IGL02553:Olfr1281	APN	2	111328988	missense	probably benign
IGL02719:Olfr1281	APN	2	111329245	nonsense	probably null
IGL02750:Olfr1281	APN	2	111329288	missense	probably damaging	1.00
IGL02873:Olfr1281	APN	2	111328872	missense	probably benign
IGL03252:Olfr1281	APN	2	111328780	nonsense	probably null
IGL03375:Olfr1281	APN	2	111328884	missense	probably damaging	1.00
R0055:Olfr1281	UTSW	2	111328525	nonsense	probably null
R0368:Olfr1281	UTSW	2	111328787	missense	probably damaging	0.99
R0497:Olfr1281	UTSW	2	111328830	missense	probably benign	0.00
R0505:Olfr1281	UTSW	2	111329328	missense	probably benign	0.00
R1557:Olfr1281	UTSW	2	111328619	missense	probably damaging	1.00
R1619:Olfr1281	UTSW	2	111328961	missense	probably benign	0.02
R1691:Olfr1281	UTSW	2	111328853	missense	probably benign	0.03
R2286:Olfr1281	UTSW	2	111328907	missense	probably benign	0.01
R4230:Olfr1281	UTSW	2	111329130	missense	probably damaging	1.00
R4274:Olfr1281	UTSW	2	111328815	missense	probably damaging	0.98
R4305:Olfr1281	UTSW	2	111329298	missense	probably null	0.82
R4495:Olfr1281	UTSW	2	111329020	missense	probably benign	0.08
R6115:Olfr1281	UTSW	2	111329213	missense	probably benign	0.03
R6615:Olfr1281	UTSW	2	111329112	missense	probably benign	0.00
R7169:Olfr1281	UTSW	2	111328598	missense	probably damaging	1.00
R7601:Olfr1281	UTSW	2	111329220	missense	probably benign	0.12
R8267:Olfr1281	UTSW	2	111328815	missense	probably benign	0.22
R8447:Olfr1281	UTSW	2	111328962	missense	possibly damaging	0.81
R8749:Olfr1281	UTSW	2	111328472	missense	possibly damaging	0.93
R8795:Olfr1281	UTSW	2	111328536	nonsense	probably null
R9269:Olfr1281	UTSW	2	111328952	missense	probably damaging	1.00
R9598:Olfr1281	UTSW	2	111329288	nonsense	probably null
R9679:Olfr1281	UTSW	2	111329000	missense	probably benign	0.00
Z1177:Olfr1281	UTSW	2	111328825	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGGAGCCTTCTGAGCTAAGAC -3'
(R):5'- AGAGGATCTGGCTCATGCAG -3'

Sequencing Primer
(F):5'- GCCTTCTGAGCTAAGACATAATATAC -3'
(R):5'- TCATGCAGCCGCCAAAGG -3'

Posted On

2016-07-22