Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Zhx3'

404613

Institutional Source

Beutler Lab

Gene Symbol

Zhx3

Ensembl Gene

ENSMUSG00000035877

Gene Name

zinc fingers and homeoboxes 3

Synonyms

9530010N21Rik, 4932418O04Rik, Tix1, 1810059C13Rik

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160748708-160872998 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160779868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 793 (M793T)

Ref Sequence

ENSEMBL: ENSMUSP00000105086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000103115] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]

AlphaFold

Q8C0Q2

Predicted Effect

probably benign
Transcript: ENSMUST00000103111
AA Change: M793T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: M793T

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	836	888	5.2e-26	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103112
AA Change: M793T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: M793T

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	836	888	5.2e-26	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103115

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109460
AA Change: M793T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: M793T

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART
ZnF_C2H2	109	132	1.08e1	SMART
low complexity region	167	189	N/A	INTRINSIC
low complexity region	238	249	N/A	INTRINSIC
HOX	300	362	1.48e-6	SMART
low complexity region	434	447	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
HOX	489	551	2.25e-11	SMART
HOX	608	669	2.04e-9	SMART
low complexity region	677	690	N/A	INTRINSIC
HOX	759	821	7.49e-8	SMART
Pfam:Homez	841	888	1.3e-17	PFAM
low complexity region	919	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127201

SMART Domains

Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133937

Predicted Effect

probably benign
Transcript: ENSMUST00000176141

SMART Domains

Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
ZnF_C2H2	77	100	1.86e0	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het

Other mutations in Zhx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Zhx3	APN	2	160780841	missense	probably damaging	0.99
IGL01759:Zhx3	APN	2	160780714	missense	probably damaging	1.00
IGL02170:Zhx3	APN	2	160779798	missense	probably damaging	1.00
IGL02550:Zhx3	APN	2	160781296	missense	probably damaging	1.00
R0497:Zhx3	UTSW	2	160779994	nonsense	probably null
R0882:Zhx3	UTSW	2	160780709	missense	probably damaging	1.00
R1396:Zhx3	UTSW	2	160781020	missense	possibly damaging	0.90
R1587:Zhx3	UTSW	2	160781693	splice site	probably null
R1646:Zhx3	UTSW	2	160781275	missense	probably damaging	1.00
R1822:Zhx3	UTSW	2	160780355	missense	probably benign	0.03
R2322:Zhx3	UTSW	2	160782028	missense	probably damaging	1.00
R3791:Zhx3	UTSW	2	160780448	missense	possibly damaging	0.94
R3899:Zhx3	UTSW	2	160780451	missense	possibly damaging	0.82
R4003:Zhx3	UTSW	2	160780889	missense	probably damaging	0.96
R4619:Zhx3	UTSW	2	160781959	missense	probably damaging	0.96
R5461:Zhx3	UTSW	2	160780018	missense	probably benign
R5648:Zhx3	UTSW	2	160781961	missense	probably damaging	1.00
R5952:Zhx3	UTSW	2	160782017	missense	probably damaging	1.00
R6035:Zhx3	UTSW	2	160779543	missense	probably benign
R6035:Zhx3	UTSW	2	160779543	missense	probably benign
R6734:Zhx3	UTSW	2	160781720	missense	probably damaging	0.99
R6988:Zhx3	UTSW	2	160779868	missense	probably benign	0.02
R7032:Zhx3	UTSW	2	160780978	missense	probably damaging	1.00
R7288:Zhx3	UTSW	2	160781122	missense	probably damaging	1.00
R7348:Zhx3	UTSW	2	160782118	nonsense	probably null
R7947:Zhx3	UTSW	2	160781095	missense	probably damaging	1.00
R8101:Zhx3	UTSW	2	160781699	missense	probably damaging	0.99
R8152:Zhx3	UTSW	2	160780775	missense	probably benign
R8831:Zhx3	UTSW	2	160780771	missense	probably benign	0.05
R8886:Zhx3	UTSW	2	160781296	missense	probably damaging	1.00
R9310:Zhx3	UTSW	2	160779473	missense	possibly damaging	0.94
R9363:Zhx3	UTSW	2	160779865	missense	probably benign	0.00
R9422:Zhx3	UTSW	2	160782100	missense	probably benign	0.00
R9687:Zhx3	UTSW	2	160781758	missense	probably benign	0.01
RF002:Zhx3	UTSW	2	160781806	missense	probably damaging	0.98
Z1088:Zhx3	UTSW	2	160779755	unclassified	probably benign
Z1176:Zhx3	UTSW	2	160781060	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGTCTTATCACAGAGGGTC -3'
(R):5'- GTGGCAAGAGTGAGTTTCCAG -3'

Sequencing Primer
(F):5'- AGAGGGTCTGCAGATCTTCCTC -3'
(R):5'- CAAGAGTGAGTTTCCAGGGATG -3'

Posted On

2016-07-22