Incidental Mutation 'R5307:Hps3'
ID 404614
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene Name HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms Hermansky-Pudlak syndrome 3
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 20050109-20089478 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20066865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 567 (S567L)
Ref Sequence ENSEMBL: ENSMUSP00000103957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000012580] [ENSMUST00000108321]
AlphaFold Q91VB4
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000012580
AA Change: S699L

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: S699L

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108321
AA Change: S567L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: S567L

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155121
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20,073,971 (GRCm39) missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20,079,956 (GRCm39) missense probably benign 0.00
IGL01320:Hps3 APN 3 20,084,633 (GRCm39) missense probably benign 0.12
IGL01364:Hps3 APN 3 20,057,469 (GRCm39) missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20,065,130 (GRCm39) missense probably damaging 1.00
IGL01843:Hps3 APN 3 20,083,165 (GRCm39) missense probably benign 0.05
IGL02294:Hps3 APN 3 20,068,212 (GRCm39) missense probably damaging 1.00
IGL02581:Hps3 APN 3 20,057,385 (GRCm39) intron probably benign
Blue UTSW 3 20,084,960 (GRCm39) missense probably damaging 1.00
earl_grey UTSW 3 20,017,173 (GRCm38) intron probably benign
gandalf UTSW 3 20,066,960 (GRCm39) nonsense probably null
pam_gray UTSW 3 20,017,173 (GRCm38) intron probably benign
R0107:Hps3 UTSW 3 20,084,960 (GRCm39) missense probably damaging 1.00
R0245:Hps3 UTSW 3 20,066,960 (GRCm39) nonsense probably null
R0421:Hps3 UTSW 3 20,083,480 (GRCm39) missense probably benign 0.00
R0524:Hps3 UTSW 3 20,066,940 (GRCm39) missense probably damaging 1.00
R0763:Hps3 UTSW 3 20,057,443 (GRCm39) missense probably damaging 1.00
R1795:Hps3 UTSW 3 20,066,859 (GRCm39) critical splice donor site probably null
R1864:Hps3 UTSW 3 20,074,123 (GRCm39) critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20,084,691 (GRCm39) missense probably benign 0.01
R2101:Hps3 UTSW 3 20,066,947 (GRCm39) missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20,056,527 (GRCm39) missense probably benign
R2268:Hps3 UTSW 3 20,067,099 (GRCm39) splice site probably benign
R2520:Hps3 UTSW 3 20,083,194 (GRCm39) missense probably damaging 1.00
R3809:Hps3 UTSW 3 20,072,976 (GRCm39) missense probably damaging 1.00
R3888:Hps3 UTSW 3 20,057,387 (GRCm39) critical splice donor site probably null
R3942:Hps3 UTSW 3 20,051,103 (GRCm39) missense probably damaging 1.00
R4022:Hps3 UTSW 3 20,089,425 (GRCm39) missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20,083,393 (GRCm39) missense probably damaging 1.00
R4739:Hps3 UTSW 3 20,084,574 (GRCm39) critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20,066,890 (GRCm39) missense probably benign 0.03
R4912:Hps3 UTSW 3 20,068,337 (GRCm39) missense probably damaging 1.00
R5859:Hps3 UTSW 3 20,063,034 (GRCm39) missense probably benign 0.02
R6140:Hps3 UTSW 3 20,051,151 (GRCm39) missense probably damaging 1.00
R6183:Hps3 UTSW 3 20,063,032 (GRCm39) missense probably benign 0.04
R6971:Hps3 UTSW 3 20,065,699 (GRCm39) missense probably damaging 1.00
R6981:Hps3 UTSW 3 20,076,984 (GRCm39) missense probably damaging 1.00
R7120:Hps3 UTSW 3 20,065,705 (GRCm39) missense probably damaging 1.00
R7146:Hps3 UTSW 3 20,063,050 (GRCm39) missense probably damaging 1.00
R7223:Hps3 UTSW 3 20,084,583 (GRCm39) missense probably benign 0.05
R7448:Hps3 UTSW 3 20,089,329 (GRCm39) missense probably damaging 0.99
R7452:Hps3 UTSW 3 20,065,592 (GRCm39) missense probably damaging 1.00
R7560:Hps3 UTSW 3 20,084,616 (GRCm39) missense probably benign 0.29
R7659:Hps3 UTSW 3 20,076,978 (GRCm39) nonsense probably null
R7769:Hps3 UTSW 3 20,072,972 (GRCm39) splice site probably null
R8050:Hps3 UTSW 3 20,057,492 (GRCm39) missense probably benign
R8242:Hps3 UTSW 3 20,068,290 (GRCm39) missense possibly damaging 0.59
R8802:Hps3 UTSW 3 20,074,070 (GRCm39) missense probably damaging 1.00
R8822:Hps3 UTSW 3 20,057,391 (GRCm39) missense probably benign
R8945:Hps3 UTSW 3 20,068,224 (GRCm39) missense probably damaging 0.99
R9111:Hps3 UTSW 3 20,084,575 (GRCm39) critical splice acceptor site probably null
R9131:Hps3 UTSW 3 20,083,350 (GRCm39) missense probably damaging 0.98
R9645:Hps3 UTSW 3 20,084,831 (GRCm39) missense probably benign 0.01
R9728:Hps3 UTSW 3 20,065,128 (GRCm39) missense probably benign 0.06
X0021:Hps3 UTSW 3 20,084,913 (GRCm39) missense probably benign 0.14
X0066:Hps3 UTSW 3 20,070,152 (GRCm39) missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20,063,065 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTACAGTGATGATGAAAGATC -3'
(R):5'- TTAGCAGCAAAAGTGGCTCAG -3'

Sequencing Primer
(F):5'- TTCAGTAGCCACTGCTGA -3'
(R):5'- GCTCAGATATTCCACATGGCTGAG -3'
Posted On 2016-07-22