Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Tnik'

404616

Institutional Source

Beutler Lab

Gene Symbol

Tnik

Ensembl Gene

ENSMUSG00000027692

Gene Name

TRAF2 and NCK interacting kinase

Synonyms

C630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28263214-28675858 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 28541972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 171 (D171E)

Ref Sequence

ENSEMBL: ENSMUSP00000124726 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]

AlphaFold

P83510

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159236
AA Change: D171E

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	691	726	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	951	958	N/A	INTRINSIC
CNH	1005	1303	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159308
AA Change: D171E

SMART Domains

Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	636	671	N/A	INTRINSIC
low complexity region	746	765	N/A	INTRINSIC
low complexity region	904	911	N/A	INTRINSIC
CNH	958	1256	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159680
AA Change: D171E

SMART Domains

Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	720	755	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	980	987	N/A	INTRINSIC
CNH	1034	1332	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000160307
AA Change: D171E

SMART Domains

Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	720	755	N/A	INTRINSIC
low complexity region	830	849	N/A	INTRINSIC
low complexity region	988	995	N/A	INTRINSIC
CNH	1042	1340	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000160518
AA Change: D171E

SMART Domains

Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	5.9e-99	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	691	726	N/A	INTRINSIC
low complexity region	801	820	N/A	INTRINSIC
low complexity region	959	966	N/A	INTRINSIC
CNH	1013	1311	9.3e-120	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160934
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	25	212	2.2e-37	PFAM
Pfam:Pkinase	25	219	5.9e-52	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161423

Predicted Effect

probably damaging
Transcript: ENSMUST00000161964
AA Change: D171E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	636	671	N/A	INTRINSIC
low complexity region	738	757	N/A	INTRINSIC
low complexity region	896	903	N/A	INTRINSIC
CNH	950	1248	1.92e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162037

Predicted Effect

unknown
Transcript: ENSMUST00000162485
AA Change: D171E

SMART Domains

Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	665	700	N/A	INTRINSIC
low complexity region	775	794	N/A	INTRINSIC
low complexity region	933	940	N/A	INTRINSIC
CNH	987	1285	1.92e-117	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162777
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: D171E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	665	700	N/A	INTRINSIC
low complexity region	767	786	N/A	INTRINSIC
low complexity region	925	932	N/A	INTRINSIC
CNH	979	1277	1.92e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193721

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Tnik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Tnik	APN	3	28654218	missense	probably damaging	1.00
IGL00726:Tnik	APN	3	28532898	missense	probably damaging	1.00
IGL01022:Tnik	APN	3	28625228	splice site	probably null
IGL01145:Tnik	APN	3	28604167	intron	probably benign
IGL01664:Tnik	APN	3	28638479	missense	probably damaging	1.00
IGL01843:Tnik	APN	3	28570858	splice site	probably null
IGL02378:Tnik	APN	3	28638459	nonsense	probably null
IGL02448:Tnik	APN	3	28621077	missense	probably null	0.01
IGL02756:Tnik	APN	3	28542030	missense	probably damaging	1.00
IGL03332:Tnik	APN	3	28666155	missense	probably damaging	1.00
delightful	UTSW	3	28604185	missense	probably damaging	1.00
Hottie	UTSW	3	28263643	start codon destroyed	probably null	0.93
Knockout	UTSW	3	28661778	missense	possibly damaging	0.91
Looker	UTSW	3	28661704	nonsense	probably null
Lovely	UTSW	3	28611970	critical splice donor site	probably null
Usher	UTSW	3	28564097	missense	possibly damaging	0.61
R0135:Tnik	UTSW	3	28607245	missense	possibly damaging	0.67
R0418:Tnik	UTSW	3	28570880	nonsense	probably null
R0540:Tnik	UTSW	3	28650159	missense	probably damaging	1.00
R0549:Tnik	UTSW	3	28570920	missense	possibly damaging	0.87
R0556:Tnik	UTSW	3	28625218	missense	possibly damaging	0.95
R0586:Tnik	UTSW	3	28577361	splice site	probably benign
R0607:Tnik	UTSW	3	28650159	missense	probably damaging	1.00
R0842:Tnik	UTSW	3	28594086	missense	possibly damaging	0.72
R1068:Tnik	UTSW	3	28532975	missense	probably damaging	1.00
R1171:Tnik	UTSW	3	28532940	missense	probably damaging	1.00
R1597:Tnik	UTSW	3	28604269	missense	probably damaging	1.00
R1638:Tnik	UTSW	3	28665740	missense	probably damaging	0.99
R1652:Tnik	UTSW	3	28604293	missense	probably benign	0.22
R1996:Tnik	UTSW	3	28665680	missense	probably damaging	1.00
R2333:Tnik	UTSW	3	28532996	missense	probably damaging	1.00
R2426:Tnik	UTSW	3	28646681	missense	probably damaging	1.00
R2509:Tnik	UTSW	3	28667915	missense	probably damaging	1.00
R3774:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R3775:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R4007:Tnik	UTSW	3	28604281	missense	probably damaging	1.00
R4119:Tnik	UTSW	3	28666175	missense	probably damaging	1.00
R4209:Tnik	UTSW	3	28359065	splice site	probably benign
R4441:Tnik	UTSW	3	28564097	missense	possibly damaging	0.61
R4611:Tnik	UTSW	3	28542100	critical splice donor site	probably null
R4714:Tnik	UTSW	3	28594077	missense	possibly damaging	0.53
R4772:Tnik	UTSW	3	28607210	missense	probably benign	0.09
R4829:Tnik	UTSW	3	28539541	intron	probably benign
R4839:Tnik	UTSW	3	28596075	missense	possibly damaging	0.86
R4898:Tnik	UTSW	3	28650086	missense	probably damaging	1.00
R5029:Tnik	UTSW	3	28665844	splice site	probably null
R5278:Tnik	UTSW	3	28650060	missense	probably damaging	1.00
R5330:Tnik	UTSW	3	28542018	missense	probably damaging	1.00
R5375:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5459:Tnik	UTSW	3	28661741	missense	probably damaging	1.00
R5708:Tnik	UTSW	3	28611971	critical splice donor site	probably null
R5749:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5751:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5780:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5837:Tnik	UTSW	3	28668053	unclassified	probably benign
R5969:Tnik	UTSW	3	28620948	missense	probably damaging	1.00
R6244:Tnik	UTSW	3	28650179	missense	probably damaging	1.00
R6273:Tnik	UTSW	3	28577500	missense	possibly damaging	0.94
R6457:Tnik	UTSW	3	28539448	missense	probably damaging	1.00
R6464:Tnik	UTSW	3	28611970	critical splice donor site	probably null
R6473:Tnik	UTSW	3	28263643	start codon destroyed	probably null	0.93
R6737:Tnik	UTSW	3	28596086	missense	possibly damaging	0.72
R7049:Tnik	UTSW	3	28661704	nonsense	probably null
R7237:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R7267:Tnik	UTSW	3	28646627	missense	probably damaging	0.99
R7445:Tnik	UTSW	3	28663909	splice site	probably null
R7499:Tnik	UTSW	3	28630594	missense	possibly damaging	0.47
R7629:Tnik	UTSW	3	28661728	missense	probably damaging	0.96
R7654:Tnik	UTSW	3	28604185	missense	probably damaging	1.00
R7886:Tnik	UTSW	3	28666139	missense	probably damaging	1.00
R8096:Tnik	UTSW	3	28661778	missense	possibly damaging	0.91
R8210:Tnik	UTSW	3	28604333	missense	possibly damaging	0.95
R8233:Tnik	UTSW	3	28554937	missense	unknown
R8386:Tnik	UTSW	3	28263674	missense	unknown
R8399:Tnik	UTSW	3	28494010	missense	unknown
R8490:Tnik	UTSW	3	28596172	missense	probably damaging	0.97
R8539:Tnik	UTSW	3	28542003	missense	probably damaging	1.00
R8751:Tnik	UTSW	3	28611908	missense	probably damaging	0.98
R8804:Tnik	UTSW	3	28594053	missense	unknown
R8966:Tnik	UTSW	3	28532895	missense	unknown
R8998:Tnik	UTSW	3	28665771	missense	probably damaging	1.00
R8999:Tnik	UTSW	3	28665771	missense	probably damaging	1.00
R9016:Tnik	UTSW	3	28638395	missense	probably damaging	1.00
R9154:Tnik	UTSW	3	28650086	missense	probably damaging	0.99
R9284:Tnik	UTSW	3	28539421	missense	unknown
R9290:Tnik	UTSW	3	28620975	missense	probably benign	0.00
R9411:Tnik	UTSW	3	28630605	missense	probably damaging	1.00
R9484:Tnik	UTSW	3	28594944	missense	unknown
X0022:Tnik	UTSW	3	28667951	missense	probably damaging	1.00
Z1176:Tnik	UTSW	3	28604324	missense	probably damaging	1.00
Z1176:Tnik	UTSW	3	28607328	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TACTGGGCCCAGAAAATGTG -3'
(R):5'- AGGTGCCTGTGAGGATCATC -3'

Sequencing Primer
(F):5'- AATGGGCTAGGTCCCTCCATAATC -3'
(R):5'- TGTGAGGATCATCCCCTGAAAAACTG -3'

Posted On

2016-07-22