Incidental Mutation 'R5307:Tnik'
ID 404616
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene Name TRAF2 and NCK interacting kinase
Synonyms C530008O15Rik, 4831440I19Rik, 1500031A17Rik, C630040K21Rik
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 28317362-28724734 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 28596121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 171 (D171E)
Ref Sequence ENSEMBL: ENSMUSP00000124726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
AlphaFold P83510
Predicted Effect possibly damaging
Transcript: ENSMUST00000159236
AA Change: D171E

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: D171E
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: D171E
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: D171E
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: D171E
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160934
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161423
Predicted Effect probably damaging
Transcript: ENSMUST00000161964
AA Change: D171E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162037
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: D171E
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162777
AA Change: D171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: D171E

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193721
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28,708,367 (GRCm39) missense probably damaging 1.00
IGL00726:Tnik APN 3 28,587,047 (GRCm39) missense probably damaging 1.00
IGL01022:Tnik APN 3 28,679,377 (GRCm39) splice site probably null
IGL01145:Tnik APN 3 28,658,316 (GRCm39) intron probably benign
IGL01664:Tnik APN 3 28,692,628 (GRCm39) missense probably damaging 1.00
IGL01843:Tnik APN 3 28,625,007 (GRCm39) splice site probably null
IGL02378:Tnik APN 3 28,692,608 (GRCm39) nonsense probably null
IGL02448:Tnik APN 3 28,675,226 (GRCm39) missense probably null 0.01
IGL02756:Tnik APN 3 28,596,179 (GRCm39) missense probably damaging 1.00
IGL03332:Tnik APN 3 28,720,304 (GRCm39) missense probably damaging 1.00
delightful UTSW 3 28,658,334 (GRCm39) missense probably damaging 1.00
Hottie UTSW 3 28,317,792 (GRCm39) start codon destroyed probably null 0.93
Knockout UTSW 3 28,715,927 (GRCm39) missense possibly damaging 0.91
Looker UTSW 3 28,715,853 (GRCm39) nonsense probably null
Lovely UTSW 3 28,666,119 (GRCm39) critical splice donor site probably null
Usher UTSW 3 28,618,246 (GRCm39) missense possibly damaging 0.61
R0135:Tnik UTSW 3 28,661,394 (GRCm39) missense possibly damaging 0.67
R0418:Tnik UTSW 3 28,625,029 (GRCm39) nonsense probably null
R0540:Tnik UTSW 3 28,704,308 (GRCm39) missense probably damaging 1.00
R0549:Tnik UTSW 3 28,625,069 (GRCm39) missense possibly damaging 0.87
R0556:Tnik UTSW 3 28,679,367 (GRCm39) missense possibly damaging 0.95
R0586:Tnik UTSW 3 28,631,510 (GRCm39) splice site probably benign
R0607:Tnik UTSW 3 28,704,308 (GRCm39) missense probably damaging 1.00
R0842:Tnik UTSW 3 28,648,235 (GRCm39) missense possibly damaging 0.72
R1068:Tnik UTSW 3 28,587,124 (GRCm39) missense probably damaging 1.00
R1171:Tnik UTSW 3 28,587,089 (GRCm39) missense probably damaging 1.00
R1597:Tnik UTSW 3 28,658,418 (GRCm39) missense probably damaging 1.00
R1638:Tnik UTSW 3 28,719,889 (GRCm39) missense probably damaging 0.99
R1652:Tnik UTSW 3 28,658,442 (GRCm39) missense probably benign 0.22
R1996:Tnik UTSW 3 28,719,829 (GRCm39) missense probably damaging 1.00
R2333:Tnik UTSW 3 28,587,145 (GRCm39) missense probably damaging 1.00
R2426:Tnik UTSW 3 28,700,830 (GRCm39) missense probably damaging 1.00
R2509:Tnik UTSW 3 28,722,064 (GRCm39) missense probably damaging 1.00
R3774:Tnik UTSW 3 28,692,568 (GRCm39) missense probably damaging 0.98
R3775:Tnik UTSW 3 28,692,568 (GRCm39) missense probably damaging 0.98
R4007:Tnik UTSW 3 28,658,430 (GRCm39) missense probably damaging 1.00
R4119:Tnik UTSW 3 28,720,324 (GRCm39) missense probably damaging 1.00
R4209:Tnik UTSW 3 28,413,214 (GRCm39) splice site probably benign
R4441:Tnik UTSW 3 28,618,246 (GRCm39) missense possibly damaging 0.61
R4611:Tnik UTSW 3 28,596,249 (GRCm39) critical splice donor site probably null
R4714:Tnik UTSW 3 28,648,226 (GRCm39) missense possibly damaging 0.53
R4772:Tnik UTSW 3 28,661,359 (GRCm39) missense probably benign 0.09
R4829:Tnik UTSW 3 28,593,690 (GRCm39) intron probably benign
R4839:Tnik UTSW 3 28,650,224 (GRCm39) missense possibly damaging 0.86
R4898:Tnik UTSW 3 28,704,235 (GRCm39) missense probably damaging 1.00
R5029:Tnik UTSW 3 28,719,993 (GRCm39) splice site probably null
R5278:Tnik UTSW 3 28,704,209 (GRCm39) missense probably damaging 1.00
R5330:Tnik UTSW 3 28,596,167 (GRCm39) missense probably damaging 1.00
R5375:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5459:Tnik UTSW 3 28,715,890 (GRCm39) missense probably damaging 1.00
R5708:Tnik UTSW 3 28,666,120 (GRCm39) critical splice donor site probably null
R5749:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5751:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5780:Tnik UTSW 3 28,648,241 (GRCm39) missense probably benign 0.02
R5837:Tnik UTSW 3 28,722,202 (GRCm39) unclassified probably benign
R5969:Tnik UTSW 3 28,675,097 (GRCm39) missense probably damaging 1.00
R6244:Tnik UTSW 3 28,704,328 (GRCm39) missense probably damaging 1.00
R6273:Tnik UTSW 3 28,631,649 (GRCm39) missense possibly damaging 0.94
R6457:Tnik UTSW 3 28,593,597 (GRCm39) missense probably damaging 1.00
R6464:Tnik UTSW 3 28,666,119 (GRCm39) critical splice donor site probably null
R6473:Tnik UTSW 3 28,317,792 (GRCm39) start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28,650,235 (GRCm39) missense possibly damaging 0.72
R7049:Tnik UTSW 3 28,715,853 (GRCm39) nonsense probably null
R7237:Tnik UTSW 3 28,692,568 (GRCm39) missense probably damaging 0.98
R7267:Tnik UTSW 3 28,700,776 (GRCm39) missense probably damaging 0.99
R7445:Tnik UTSW 3 28,718,058 (GRCm39) splice site probably null
R7499:Tnik UTSW 3 28,684,743 (GRCm39) missense possibly damaging 0.47
R7629:Tnik UTSW 3 28,715,877 (GRCm39) missense probably damaging 0.96
R7654:Tnik UTSW 3 28,658,334 (GRCm39) missense probably damaging 1.00
R7886:Tnik UTSW 3 28,720,288 (GRCm39) missense probably damaging 1.00
R8096:Tnik UTSW 3 28,715,927 (GRCm39) missense possibly damaging 0.91
R8210:Tnik UTSW 3 28,658,482 (GRCm39) missense possibly damaging 0.95
R8233:Tnik UTSW 3 28,609,086 (GRCm39) missense unknown
R8386:Tnik UTSW 3 28,317,823 (GRCm39) missense unknown
R8399:Tnik UTSW 3 28,548,159 (GRCm39) missense unknown
R8490:Tnik UTSW 3 28,650,321 (GRCm39) missense probably damaging 0.97
R8539:Tnik UTSW 3 28,596,152 (GRCm39) missense probably damaging 1.00
R8751:Tnik UTSW 3 28,666,057 (GRCm39) missense probably damaging 0.98
R8804:Tnik UTSW 3 28,648,202 (GRCm39) missense unknown
R8966:Tnik UTSW 3 28,587,044 (GRCm39) missense unknown
R8998:Tnik UTSW 3 28,719,920 (GRCm39) missense probably damaging 1.00
R8999:Tnik UTSW 3 28,719,920 (GRCm39) missense probably damaging 1.00
R9016:Tnik UTSW 3 28,692,544 (GRCm39) missense probably damaging 1.00
R9154:Tnik UTSW 3 28,704,235 (GRCm39) missense probably damaging 0.99
R9284:Tnik UTSW 3 28,593,570 (GRCm39) missense unknown
R9290:Tnik UTSW 3 28,675,124 (GRCm39) missense probably benign 0.00
R9411:Tnik UTSW 3 28,684,754 (GRCm39) missense probably damaging 1.00
R9484:Tnik UTSW 3 28,649,093 (GRCm39) missense unknown
X0022:Tnik UTSW 3 28,722,100 (GRCm39) missense probably damaging 1.00
Z1176:Tnik UTSW 3 28,661,477 (GRCm39) missense probably damaging 0.96
Z1176:Tnik UTSW 3 28,658,473 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGGCCCAGAAAATGTG -3'
(R):5'- AGGTGCCTGTGAGGATCATC -3'

Sequencing Primer
(F):5'- AATGGGCTAGGTCCCTCCATAATC -3'
(R):5'- TGTGAGGATCATCCCCTGAAAAACTG -3'
Posted On 2016-07-22