Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Stxbp3'

404618

Institutional Source

Beutler Lab

Gene Symbol

Stxbp3

Ensembl Gene

ENSMUSG00000027882

Gene Name

syntaxin binding protein 3

Synonyms

Stxbp3, Stxbp3a, Munc-18c

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108793176-108840526 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108793798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 585 (D585G)

Ref Sequence

ENSEMBL: ENSMUSP00000099681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102621]

AlphaFold

Q60770

PDB Structure

Re-refinement of the crystal structure of Munc18-3 and Syntaxin4 N-peptide complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102621
AA Change: D585G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099681
Gene: ENSMUSG00000027882
AA Change: D585G

Domain	Start	End	E-Value	Type
Pfam:Sec1	33	576	5.9e-107	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124782

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124903

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display embryonic or perinatal lethality with reduced embryonic growth and malformation of the intermediate zone of the cerebral cortex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Stxbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Stxbp3	APN	3	108816351	missense	probably benign	0.05
IGL01370:Stxbp3	APN	3	108797425	nonsense	probably null
IGL01810:Stxbp3	APN	3	108800152	missense	probably benign	0.35
IGL02583:Stxbp3	APN	3	108800871	missense	probably damaging	1.00
IGL02827:Stxbp3	APN	3	108809895	missense	probably damaging	1.00
IGL03022:Stxbp3	APN	3	108800756	missense	probably damaging	1.00
IGL03198:Stxbp3	APN	3	108827089	missense	probably damaging	0.96
IGL03410:Stxbp3	APN	3	108802160	missense	probably damaging	1.00
G1patch:Stxbp3	UTSW	3	108827600	missense	possibly damaging	0.47
R0666:Stxbp3	UTSW	3	108805302	missense	possibly damaging	0.49
R3887:Stxbp3	UTSW	3	108805233	splice site	probably null
R4128:Stxbp3	UTSW	3	108794831	missense	probably benign	0.03
R4683:Stxbp3	UTSW	3	108800872	missense	probably damaging	1.00
R5106:Stxbp3	UTSW	3	108794927	missense	probably benign	0.01
R6643:Stxbp3	UTSW	3	108793834	missense	probably damaging	1.00
R6722:Stxbp3	UTSW	3	108816446	missense	probably benign	0.03
R6725:Stxbp3	UTSW	3	108827600	missense	possibly damaging	0.47
R7110:Stxbp3	UTSW	3	108816333	missense	probably damaging	1.00
R7135:Stxbp3	UTSW	3	108800755	missense	probably damaging	1.00
R7231:Stxbp3	UTSW	3	108800809	missense	probably damaging	1.00
R7769:Stxbp3	UTSW	3	108800828	missense	probably benign
R8688:Stxbp3	UTSW	3	108802109	critical splice donor site	probably benign
R9048:Stxbp3	UTSW	3	108816388	missense	probably benign	0.33
R9503:Stxbp3	UTSW	3	108803595	missense	probably damaging	1.00
R9523:Stxbp3	UTSW	3	108840440	missense	probably damaging	1.00
X0020:Stxbp3	UTSW	3	108793847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCTTGTACAAAGCAGCAACAG -3'
(R):5'- CTCAGTGACAAGGGTTGATGTG -3'

Sequencing Primer
(F):5'- CCATACACTATTTACACCGC -3'
(R):5'- GAATTTTGGAGACATGCTGTTAGAAG -3'

Posted On

2016-07-22