Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Svep1'

404621

Institutional Source

Beutler Lab

Gene Symbol

Svep1

Ensembl Gene

ENSMUSG00000028369

Gene Name

sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1

Synonyms

D430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58042442-58206859 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58072677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 2211 (N2211D)

Ref Sequence

ENSEMBL: ENSMUSP00000045856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042850]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042850
AA Change: N2211D

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: N2211D

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	51	60	N/A	INTRINSIC
VWA	82	261	2.18e-32	SMART
Pfam:GCC2_GCC3	311	361	3.4e-14	PFAM
CCP	379	434	3.62e-8	SMART
CCP	439	494	1.78e-16	SMART
CCP	499	559	2.13e-5	SMART
Pfam:HYR	560	642	1.7e-20	PFAM
Pfam:HYR	643	722	4.6e-15	PFAM
CCP	727	787	3.59e-1	SMART
low complexity region	862	873	N/A	INTRINSIC
Pfam:GCC2_GCC3	1004	1051	3.2e-16	PFAM
Pfam:GCC2_GCC3	1058	1105	5.4e-19	PFAM
Pfam:GCC2_GCC3	1112	1159	7.7e-19	PFAM
EGF	1195	1228	3.12e-7	SMART
EGF_CA	1230	1266	3.93e-13	SMART
EGF_CA	1268	1304	8.3e-12	SMART
EGF_CA	1306	1342	4.59e-14	SMART
EGF_CA	1344	1380	8.69e-15	SMART
EGF_CA	1382	1418	3.42e-13	SMART
Pfam:Pentaxin	1429	1622	1.8e-28	PFAM
Pfam:Laminin_G_3	1432	1589	1.1e-20	PFAM
CCP	1630	1684	1.71e-9	SMART
CCP	1689	1742	2.31e-15	SMART
EGF_CA	1744	1783	5.23e-9	SMART
CCP	1788	1841	4.62e-15	SMART
CCP	1846	1899	8.29e-17	SMART
CCP	1904	1957	1.1e-12	SMART
CCP	1962	2015	5.6e-14	SMART
CCP	2020	2077	4.15e-8	SMART
CCP	2082	2140	8.11e-11	SMART
CCP	2145	2198	4.38e-16	SMART
CCP	2203	2258	1.69e-8	SMART
CCP	2263	2317	1.42e-15	SMART
CCP	2322	2375	3.1e-7	SMART
CCP	2380	2434	4.55e-14	SMART
CCP	2439	2492	6.95e-10	SMART
CCP	2497	2550	8.88e-17	SMART
CCP	2555	2607	1.7e-13	SMART
CCP	2651	2709	1.02e-7	SMART
CCP	2714	2767	9.6e-13	SMART
CCP	2772	2825	3.64e-13	SMART
CCP	2830	2883	6.63e-16	SMART
CCP	2888	2941	2.76e-13	SMART
CCP	2946	2999	4.41e-12	SMART
CCP	3004	3055	4.25e-5	SMART
CCP	3060	3113	5.15e-13	SMART
CCP	3118	3172	2.11e-9	SMART
CCP	3177	3232	1.02e-7	SMART
CCP	3237	3290	6.19e-16	SMART
CCP	3295	3348	5.35e-11	SMART
CCP	3353	3407	8.43e-9	SMART
CCP	3412	3464	2.44e-14	SMART
EGF	3467	3496	1.28e-3	SMART
EGF	3499	3528	1.15e-5	SMART
EGF	3531	3560	2.85e-1	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Svep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Svep1	APN	4	58176077	missense	probably damaging	0.98
IGL00489:Svep1	APN	4	58068988	missense	possibly damaging	0.71
IGL00496:Svep1	APN	4	58069001	missense	possibly damaging	0.95
IGL00864:Svep1	APN	4	58068533	nonsense	probably null
IGL00904:Svep1	APN	4	58097398	missense	probably benign	0.00
IGL00935:Svep1	APN	4	58090664	missense	possibly damaging	0.71
IGL00963:Svep1	APN	4	58072791	nonsense	probably null
IGL01077:Svep1	APN	4	58068760	missense	possibly damaging	0.71
IGL01084:Svep1	APN	4	58111419	missense	possibly damaging	0.71
IGL01150:Svep1	APN	4	58070302	missense	probably benign	0.04
IGL01161:Svep1	APN	4	58146569	missense	probably damaging	0.96
IGL01360:Svep1	APN	4	58116554	missense	possibly damaging	0.73
IGL01365:Svep1	APN	4	58100878	critical splice acceptor site	probably null
IGL01396:Svep1	APN	4	58068552	missense	possibly damaging	0.85
IGL01601:Svep1	APN	4	58084872	missense	probably damaging	1.00
IGL01636:Svep1	APN	4	58116622	missense	possibly damaging	0.96
IGL01838:Svep1	APN	4	58121910	missense	possibly damaging	0.72
IGL01949:Svep1	APN	4	58176006	missense	probably damaging	1.00
IGL01984:Svep1	APN	4	58068877	missense	possibly damaging	0.93
IGL02005:Svep1	APN	4	58069056	missense	possibly damaging	0.93
IGL02036:Svep1	APN	4	58088245	missense	possibly damaging	0.85
IGL02039:Svep1	APN	4	58123980	critical splice donor site	probably null
IGL02043:Svep1	APN	4	58068556	missense	probably benign	0.19
IGL02073:Svep1	APN	4	58070104	missense	probably benign	0.06
IGL02188:Svep1	APN	4	58068382	missense	possibly damaging	0.71
IGL02256:Svep1	APN	4	58070311	missense	possibly damaging	0.71
IGL02284:Svep1	APN	4	58072819	missense	probably benign	0.32
IGL02323:Svep1	APN	4	58070236	nonsense	probably null
IGL02440:Svep1	APN	4	58145293	missense	probably benign	0.06
IGL02449:Svep1	APN	4	58070296	missense	possibly damaging	0.71
IGL02501:Svep1	APN	4	58145341	splice site	probably benign
IGL02568:Svep1	APN	4	58135441	missense	probably benign	0.42
IGL02625:Svep1	APN	4	58115807	missense	possibly damaging	0.53
IGL02795:Svep1	APN	4	58123223	missense	probably damaging	1.00
IGL02818:Svep1	APN	4	58069804	missense	possibly damaging	0.71
IGL02871:Svep1	APN	4	58100871	missense	probably benign
IGL02875:Svep1	APN	4	58082821	splice site	probably benign
IGL02887:Svep1	APN	4	58145301	missense	probably damaging	1.00
IGL03240:Svep1	APN	4	58048188	missense	possibly damaging	0.73
IGL03243:Svep1	APN	4	58133387	missense	probably benign	0.06
IGL03264:Svep1	APN	4	58066422	splice site	probably benign
IGL03288:Svep1	APN	4	58116532	missense	probably benign	0.01
IGL03340:Svep1	APN	4	58111451	missense	possibly damaging	0.96
IGL03341:Svep1	APN	4	58070308	nonsense	probably null
IGL03348:Svep1	APN	4	58113635	missense	probably damaging	1.00
R0001:Svep1	UTSW	4	58066460	missense	possibly damaging	0.93
R0042:Svep1	UTSW	4	58123192	missense	possibly damaging	0.92
R0042:Svep1	UTSW	4	58123192	missense	possibly damaging	0.92
R0125:Svep1	UTSW	4	58099937	splice site	probably benign
R0142:Svep1	UTSW	4	58118232	missense	probably benign	0.33
R0147:Svep1	UTSW	4	58116608	missense	possibly damaging	0.85
R0148:Svep1	UTSW	4	58116608	missense	possibly damaging	0.85
R0157:Svep1	UTSW	4	58069830	missense	possibly damaging	0.72
R0195:Svep1	UTSW	4	58089514	missense	possibly damaging	0.82
R0197:Svep1	UTSW	4	58070851	missense	possibly damaging	0.71
R0257:Svep1	UTSW	4	58179610	missense	possibly damaging	0.71
R0314:Svep1	UTSW	4	58096331	missense	possibly damaging	0.71
R0316:Svep1	UTSW	4	58072737	missense	probably damaging	0.98
R0322:Svep1	UTSW	4	58057996	splice site	probably benign
R0426:Svep1	UTSW	4	58073333	missense	possibly damaging	0.87
R0446:Svep1	UTSW	4	58088280	missense	probably damaging	1.00
R0457:Svep1	UTSW	4	58118136	missense	probably damaging	1.00
R0471:Svep1	UTSW	4	58054700	missense	possibly damaging	0.85
R0555:Svep1	UTSW	4	58128858	missense	possibly damaging	0.71
R0634:Svep1	UTSW	4	58070661	missense	possibly damaging	0.86
R0636:Svep1	UTSW	4	58073121	nonsense	probably null
R0827:Svep1	UTSW	4	58053113	splice site	probably benign
R1025:Svep1	UTSW	4	58087817	missense	possibly damaging	0.86
R1027:Svep1	UTSW	4	58094084	missense	possibly damaging	0.86
R1069:Svep1	UTSW	4	58070239	missense	probably damaging	1.00
R1161:Svep1	UTSW	4	58069416	missense	possibly damaging	0.71
R1245:Svep1	UTSW	4	58066427	critical splice donor site	probably null
R1282:Svep1	UTSW	4	58100032	missense	possibly damaging	0.93
R1310:Svep1	UTSW	4	58069416	missense	possibly damaging	0.71
R1444:Svep1	UTSW	4	58115754	missense	possibly damaging	0.53
R1460:Svep1	UTSW	4	58068740	missense	possibly damaging	0.85
R1500:Svep1	UTSW	4	58070239	missense	probably damaging	1.00
R1628:Svep1	UTSW	4	58107561	missense	probably benign	0.00
R1712:Svep1	UTSW	4	58070629	missense	probably benign	0.06
R1774:Svep1	UTSW	4	58146562	missense	possibly damaging	0.92
R1783:Svep1	UTSW	4	58073333	missense	probably benign
R1829:Svep1	UTSW	4	58096310	missense	possibly damaging	0.93
R1978:Svep1	UTSW	4	58097292	missense	possibly damaging	0.73
R1993:Svep1	UTSW	4	58064170	critical splice donor site	probably null
R2017:Svep1	UTSW	4	58070568	missense	probably benign	0.08
R2058:Svep1	UTSW	4	58084554	missense	possibly damaging	0.92
R2109:Svep1	UTSW	4	58206030	missense	possibly damaging	0.51
R2215:Svep1	UTSW	4	58138602	splice site	probably benign
R2281:Svep1	UTSW	4	58082677	missense	possibly damaging	0.85
R2504:Svep1	UTSW	4	58135628	splice site	probably null
R2763:Svep1	UTSW	4	58084061	missense	possibly damaging	0.86
R3122:Svep1	UTSW	4	58087845	missense	possibly damaging	0.51
R3605:Svep1	UTSW	4	58066542	missense	probably benign	0.32
R3763:Svep1	UTSW	4	58084833	missense	possibly damaging	0.89
R3827:Svep1	UTSW	4	58096177	missense	probably damaging	0.98
R3829:Svep1	UTSW	4	58096177	missense	probably damaging	0.98
R3830:Svep1	UTSW	4	58096177	missense	probably damaging	0.98
R3910:Svep1	UTSW	4	58145156	critical splice donor site	probably null
R3943:Svep1	UTSW	4	58084807	splice site	probably null
R3944:Svep1	UTSW	4	58084807	splice site	probably null
R4153:Svep1	UTSW	4	58089426	missense	possibly damaging	0.52
R4154:Svep1	UTSW	4	58069068	missense	possibly damaging	0.71
R4191:Svep1	UTSW	4	58046601	missense	possibly damaging	0.86
R4355:Svep1	UTSW	4	58138695	missense	possibly damaging	0.71
R4388:Svep1	UTSW	4	58069249	missense	possibly damaging	0.93
R4532:Svep1	UTSW	4	58068886	missense	possibly damaging	0.52
R4584:Svep1	UTSW	4	58068526	nonsense	probably null
R4592:Svep1	UTSW	4	58084028	missense	possibly damaging	0.93
R4593:Svep1	UTSW	4	58091944	missense	possibly damaging	0.71
R4625:Svep1	UTSW	4	58072698	missense	probably damaging	0.98
R4639:Svep1	UTSW	4	58082724	missense	probably benign
R4700:Svep1	UTSW	4	58097323	missense	possibly damaging	0.71
R4720:Svep1	UTSW	4	58205869	missense	possibly damaging	0.71
R4724:Svep1	UTSW	4	58070752	missense	possibly damaging	0.71
R4753:Svep1	UTSW	4	58053212	missense	probably benign	0.06
R4781:Svep1	UTSW	4	58070340	missense	probably damaging	0.98
R4820:Svep1	UTSW	4	58082664	missense	probably benign	0.27
R4896:Svep1	UTSW	4	58087751	missense	probably benign	0.08
R4905:Svep1	UTSW	4	58069308	missense	probably benign	0.00
R4910:Svep1	UTSW	4	58096276	missense	possibly damaging	0.71
R4972:Svep1	UTSW	4	58087778	missense	possibly damaging	0.71
R5004:Svep1	UTSW	4	58087751	missense	probably benign	0.08
R5088:Svep1	UTSW	4	58120648	missense	possibly damaging	0.73
R5112:Svep1	UTSW	4	58068610	nonsense	probably null
R5185:Svep1	UTSW	4	58084534	missense	probably damaging	0.99
R5302:Svep1	UTSW	4	58096183	missense	possibly damaging	0.71
R5339:Svep1	UTSW	4	58121892	missense	possibly damaging	0.96
R5379:Svep1	UTSW	4	58072991	missense	possibly damaging	0.51
R5384:Svep1	UTSW	4	58104545	missense	possibly damaging	0.71
R5414:Svep1	UTSW	4	58206322	missense	possibly damaging	0.53
R5514:Svep1	UTSW	4	58044054	missense	possibly damaging	0.53
R5538:Svep1	UTSW	4	58049282	critical splice acceptor site	probably null
R5549:Svep1	UTSW	4	58057954	missense	probably benign	0.32
R5618:Svep1	UTSW	4	58070537	missense	probably benign
R5623:Svep1	UTSW	4	58091964	missense	possibly damaging	0.92
R5686:Svep1	UTSW	4	58072826	missense	possibly damaging	0.71
R5743:Svep1	UTSW	4	58096223	missense	possibly damaging	0.71
R5773:Svep1	UTSW	4	58099985	missense	possibly damaging	0.86
R5809:Svep1	UTSW	4	58116524	missense	possibly damaging	0.73
R5896:Svep1	UTSW	4	58084906	missense	possibly damaging	0.71
R5918:Svep1	UTSW	4	58069345	missense	possibly damaging	0.71
R5969:Svep1	UTSW	4	58070977	nonsense	probably null
R6010:Svep1	UTSW	4	58115832	missense	possibly damaging	0.95
R6187:Svep1	UTSW	4	58072872	missense	probably damaging	1.00
R6192:Svep1	UTSW	4	58104536	missense	possibly damaging	0.92
R6209:Svep1	UTSW	4	58128869	missense	probably benign	0.32
R6234:Svep1	UTSW	4	58113458	splice site	probably null
R6326:Svep1	UTSW	4	58073045	missense	possibly damaging	0.51
R6400:Svep1	UTSW	4	58049169	missense	probably damaging	1.00
R6418:Svep1	UTSW	4	58053126	missense	probably benign	0.01
R6440:Svep1	UTSW	4	58116555	missense	possibly damaging	0.53
R6489:Svep1	UTSW	4	58100066	missense	probably damaging	1.00
R6515:Svep1	UTSW	4	58088280	missense	probably damaging	1.00
R6738:Svep1	UTSW	4	58123180	missense	possibly damaging	0.71
R6773:Svep1	UTSW	4	58049146	missense	possibly damaging	0.71
R6796:Svep1	UTSW	4	58064275	missense	probably benign	0.01
R7055:Svep1	UTSW	4	58064275	missense	probably benign	0.19
R7055:Svep1	UTSW	4	58120642	missense	probably benign	0.33
R7111:Svep1	UTSW	4	58118207	missense	possibly damaging	0.70
R7161:Svep1	UTSW	4	58128859	missense	possibly damaging	0.93
R7162:Svep1	UTSW	4	58070262	missense	possibly damaging	0.71
R7182:Svep1	UTSW	4	58043991	missense	probably benign	0.18
R7292:Svep1	UTSW	4	58111395	missense	possibly damaging	0.71
R7299:Svep1	UTSW	4	58046587	nonsense	probably null
R7301:Svep1	UTSW	4	58046587	nonsense	probably null
R7316:Svep1	UTSW	4	58068763	missense	possibly damaging	0.71
R7337:Svep1	UTSW	4	58108323	missense	probably damaging	0.98
R7391:Svep1	UTSW	4	58145185	missense	probably damaging	0.98
R7402:Svep1	UTSW	4	58069699	missense	possibly damaging	0.71
R7445:Svep1	UTSW	4	58094122	missense	possibly damaging	0.85
R7450:Svep1	UTSW	4	58064248	missense	possibly damaging	0.71
R7492:Svep1	UTSW	4	58066468	missense	possibly damaging	0.51
R7505:Svep1	UTSW	4	58115862	missense	possibly damaging	0.53
R7509:Svep1	UTSW	4	58090683	missense	probably benign	0.40
R7538:Svep1	UTSW	4	58053260	missense	possibly damaging	0.71
R7555:Svep1	UTSW	4	58069422	missense	probably damaging	0.98
R7660:Svep1	UTSW	4	58087782	missense	probably benign	0.32
R7670:Svep1	UTSW	4	58097424	missense	probably damaging	1.00
R7719:Svep1	UTSW	4	58068523	missense	probably damaging	0.97
R7733:Svep1	UTSW	4	58049239	missense	probably benign	0.03
R7781:Svep1	UTSW	4	58069251	missense	possibly damaging	0.71
R7821:Svep1	UTSW	4	58179601	missense	probably damaging	0.99
R7832:Svep1	UTSW	4	58054539	missense	probably benign	0.44
R8017:Svep1	UTSW	4	58146637	missense	probably damaging	0.99
R8019:Svep1	UTSW	4	58146637	missense	probably damaging	0.99
R8066:Svep1	UTSW	4	58113650	missense	probably benign	0.33
R8159:Svep1	UTSW	4	58069396	missense	possibly damaging	0.71
R8159:Svep1	UTSW	4	58087815	missense	probably benign	0.01
R8170:Svep1	UTSW	4	58069378	missense	probably benign	0.00
R8246:Svep1	UTSW	4	58091889	missense	probably damaging	0.96
R8392:Svep1	UTSW	4	58070566	missense	possibly damaging	0.71
R8436:Svep1	UTSW	4	58044053	missense	possibly damaging	0.86
R8544:Svep1	UTSW	4	58206025	missense	probably benign	0.00
R8669:Svep1	UTSW	4	58070119	missense	possibly damaging	0.95
R8707:Svep1	UTSW	4	58070197	nonsense	probably null
R8790:Svep1	UTSW	4	58118145	missense	possibly damaging	0.53
R8804:Svep1	UTSW	4	58206043	missense	possibly damaging	0.86
R8868:Svep1	UTSW	4	58135578	missense	possibly damaging	0.77
R8880:Svep1	UTSW	4	58064204	missense	possibly damaging	0.51
R8949:Svep1	UTSW	4	58054604	missense	possibly damaging	0.85
R9007:Svep1	UTSW	4	58091915	missense	possibly damaging	0.86
R9028:Svep1	UTSW	4	58145199	missense	possibly damaging	0.92
R9131:Svep1	UTSW	4	58087778	missense	possibly damaging	0.71
R9285:Svep1	UTSW	4	58084809	critical splice donor site	probably null
R9302:Svep1	UTSW	4	58120565	missense	possibly damaging	0.53
R9314:Svep1	UTSW	4	58070347	missense	probably damaging	1.00
R9427:Svep1	UTSW	4	58069804	missense	possibly damaging	0.71
R9443:Svep1	UTSW	4	58179697	missense	possibly damaging	0.95
R9473:Svep1	UTSW	4	58064243	missense	probably benign	0.00
R9487:Svep1	UTSW	4	58070517	missense	probably benign
R9494:Svep1	UTSW	4	58070577	missense	possibly damaging	0.51
R9515:Svep1	UTSW	4	58084144	missense	possibly damaging	0.71
R9681:Svep1	UTSW	4	58084959	missense	probably damaging	0.98
X0063:Svep1	UTSW	4	58070468	nonsense	probably null
Z1176:Svep1	UTSW	4	58111386	missense	probably damaging	0.97
Z1176:Svep1	UTSW	4	58115814	missense	possibly damaging	0.93
Z1176:Svep1	UTSW	4	58133415	missense	possibly damaging	0.51
Z1177:Svep1	UTSW	4	58115841	missense	possibly damaging	0.91
Z1177:Svep1	UTSW	4	58206300	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCTACTATAATGCAGAAAGATGC -3'
(R):5'- ATCGCAAATGGCTACCCGAG -3'

Sequencing Primer
(F):5'- TGGCTATATGTGCAGGCCAATACC -3'
(R):5'- CCGAGTGGGACAAACTACAGTTTTG -3'

Posted On

2016-07-22