Incidental Mutation 'R5307:Whrn'
ID 404622
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms C430046P22Rik, Dfnb31, wi, 1110035G07Rik
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 63414910-63495991 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 63431843 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 546 (H546N)
Ref Sequence ENSEMBL: ENSMUSP00000065838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
AlphaFold Q80VW5
Predicted Effect probably benign
Transcript: ENSMUST00000063650
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063672
AA Change: H546N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: H546N

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084510
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102867
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148957
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R0631:Whrn UTSW 4 63419489 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5207:Whrn UTSW 4 63432714 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5463:Whrn UTSW 4 63432816 missense probably benign 0.08
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6212:Whrn UTSW 4 63494686 nonsense probably null
R6380:Whrn UTSW 4 63418592 missense possibly damaging 0.90
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
R8334:Whrn UTSW 4 63494810 missense probably damaging 1.00
R9378:Whrn UTSW 4 63431842 missense probably benign 0.00
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Z1176:Whrn UTSW 4 63415566 missense probably damaging 1.00
Z1177:Whrn UTSW 4 63418499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAATAGCCCTTAGGAAACCTTTC -3'
(R):5'- TCCTGTCTGAGGTGAGAAGC -3'

Sequencing Primer
(F):5'- CCCTCTATCCCCAGACTGAGAG -3'
(R):5'- CCTGTCTGAGGTGAGAAGCATCATC -3'
Posted On 2016-07-22