Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Ephb2'

404625

Institutional Source

Beutler Lab

Gene Symbol

Ephb2

Ensembl Gene

ENSMUSG00000028664

Gene Name

Eph receptor B2

Synonyms

Erk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.775) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136647539-136835988 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 136693787 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 417 (Q417H)

Ref Sequence

ENSEMBL: ENSMUSP00000101472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]

AlphaFold

P54763

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059287
AA Change: Q417H

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: Q417H

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	261	304	8.1e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	518	1.23e-10	SMART
Pfam:EphA2_TM	545	619	6e-25	PFAM
TyrKc	622	881	1.34e-138	SMART
SAM	911	978	1.18e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105845
AA Change: Q417H

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: Q417H

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	259	305	2.2e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	517	1.41e-10	SMART
Pfam:EphA2_TM	543	618	2.1e-30	PFAM
TyrKc	621	880	1.34e-138	SMART
SAM	910	977	1.18e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105846
AA Change: Q417H

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: Q417H

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EPH_lbd	20	197	7.37e-130	SMART
Pfam:GCC2_GCC3	259	305	2.2e-10	PFAM
FN3	325	417	1.75e-6	SMART
FN3	436	517	1.41e-10	SMART
Pfam:EphA2_TM	543	619	1e-30	PFAM
TyrKc	622	881	1.34e-138	SMART
SAM	911	978	1.18e-23	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000156558
AA Change: Q84H

SMART Domains

Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664
AA Change: Q84H

Domain	Start	End	E-Value	Type
FN3	1	85	6.48e1	SMART
FN3	104	186	1.23e-10	SMART
Pfam:EphA2_TM	213	276	2.5e-16	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Ephb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ephb2	APN	4	136657484	missense	probably damaging	0.96
IGL00963:Ephb2	APN	4	136658951	missense	probably benign	0.04
IGL01111:Ephb2	APN	4	136657410	missense	probably benign	0.01
IGL01462:Ephb2	APN	4	136771370	missense	possibly damaging	0.61
IGL01863:Ephb2	APN	4	136659777	missense	probably benign	0.03
IGL02149:Ephb2	APN	4	136693914	missense	probably damaging	1.00
IGL02232:Ephb2	APN	4	136657451	missense	probably damaging	0.97
IGL02269:Ephb2	APN	4	136771049	missense	possibly damaging	0.66
IGL02828:Ephb2	APN	4	136771150	missense	probably benign	0.09
IGL03109:Ephb2	APN	4	136771544	missense	probably damaging	1.00
IGL03284:Ephb2	APN	4	136661516	missense	probably damaging	0.96
Zimbalist	UTSW	4	136659709	missense	probably damaging	1.00
BB006:Ephb2	UTSW	4	136660884	missense	probably damaging	1.00
BB016:Ephb2	UTSW	4	136660884	missense	probably damaging	1.00
PIT4453001:Ephb2	UTSW	4	136660810	missense	probably benign	0.00
R0004:Ephb2	UTSW	4	136657524	missense	probably damaging	1.00
R0121:Ephb2	UTSW	4	136771057	missense	probably damaging	0.99
R0539:Ephb2	UTSW	4	136655976	missense	probably damaging	1.00
R0614:Ephb2	UTSW	4	136673365	missense	probably benign	0.00
R0988:Ephb2	UTSW	4	136659708	missense	possibly damaging	0.59
R1471:Ephb2	UTSW	4	136658951	missense	probably benign	0.04
R1473:Ephb2	UTSW	4	136694058	missense	possibly damaging	0.83
R1546:Ephb2	UTSW	4	136771009	missense	probably damaging	0.99
R1639:Ephb2	UTSW	4	136693905	missense	probably benign	0.10
R1725:Ephb2	UTSW	4	136659778	nonsense	probably null
R1779:Ephb2	UTSW	4	136693825	missense	possibly damaging	0.64
R1818:Ephb2	UTSW	4	136655336	missense	probably benign	0.02
R2099:Ephb2	UTSW	4	136660755	missense	probably damaging	1.00
R2916:Ephb2	UTSW	4	136683945	missense	probably damaging	0.99
R3885:Ephb2	UTSW	4	136771034	missense	probably damaging	1.00
R4572:Ephb2	UTSW	4	136655940	missense	probably damaging	1.00
R4709:Ephb2	UTSW	4	136696052	missense	probably damaging	1.00
R4893:Ephb2	UTSW	4	136659753	missense	probably damaging	0.99
R4981:Ephb2	UTSW	4	136696010	missense	probably benign	0.09
R4992:Ephb2	UTSW	4	136660839	missense	probably damaging	1.00
R5004:Ephb2	UTSW	4	136659699	missense	possibly damaging	0.77
R5370:Ephb2	UTSW	4	136771570	missense	probably benign	0.00
R5561:Ephb2	UTSW	4	136661406	missense	probably damaging	1.00
R5643:Ephb2	UTSW	4	136771612	missense	probably damaging	0.99
R5826:Ephb2	UTSW	4	136660737	missense	probably damaging	1.00
R5858:Ephb2	UTSW	4	136672445	missense	probably benign
R5867:Ephb2	UTSW	4	136675422	missense	possibly damaging	0.81
R5990:Ephb2	UTSW	4	136696055	missense	probably benign	0.03
R6000:Ephb2	UTSW	4	136684030	missense	possibly damaging	0.76
R6156:Ephb2	UTSW	4	136661505	missense	probably benign	0.44
R6413:Ephb2	UTSW	4	136771122	missense	probably benign	0.08
R6577:Ephb2	UTSW	4	136657550	missense	probably damaging	0.99
R6633:Ephb2	UTSW	4	136683996	missense	probably benign	0.07
R6720:Ephb2	UTSW	4	136657502	missense	probably damaging	0.99
R6795:Ephb2	UTSW	4	136673335	missense	possibly damaging	0.88
R7235:Ephb2	UTSW	4	136693828	missense	probably damaging	1.00
R7260:Ephb2	UTSW	4	136771574	missense	probably damaging	0.96
R7328:Ephb2	UTSW	4	136658934	critical splice donor site	probably null
R7404:Ephb2	UTSW	4	136771213	missense	probably damaging	1.00
R7466:Ephb2	UTSW	4	136659065	missense	probably damaging	1.00
R7524:Ephb2	UTSW	4	136659709	missense	probably damaging	1.00
R7605:Ephb2	UTSW	4	136771108	missense	probably damaging	1.00
R7611:Ephb2	UTSW	4	136660901	critical splice acceptor site	probably null
R7777:Ephb2	UTSW	4	136771636	missense	possibly damaging	0.92
R7889:Ephb2	UTSW	4	136771042	missense	probably damaging	0.99
R7929:Ephb2	UTSW	4	136660884	missense	probably damaging	1.00
R8191:Ephb2	UTSW	4	136658945	missense	probably damaging	0.96
R8370:Ephb2	UTSW	4	136655991	missense	possibly damaging	0.95
R8444:Ephb2	UTSW	4	136661400	missense	probably damaging	1.00
R8724:Ephb2	UTSW	4	136771057	missense	probably damaging	0.99
R8988:Ephb2	UTSW	4	136675458	missense	probably benign	0.42
R9410:Ephb2	UTSW	4	136659637	missense	probably null	1.00
R9722:Ephb2	UTSW	4	136657457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAAATACTACTACTGAGCCC -3'
(R):5'- TCATCTGCAAGAGCTGTGGC -3'

Sequencing Primer
(F):5'- GGCTGCCCTCAAATTCACG -3'
(R):5'- TACATCAGTGACCTGCTG -3'

Posted On

2016-07-22