Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Tnfrsf18'

404626

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf18

Ensembl Gene

ENSMUSG00000041954

Gene Name

tumor necrosis factor receptor superfamily, member 18

Synonyms

Gitr

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

156026164-156028895 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 156028424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040274] [ENSMUST00000103173] [ENSMUST00000122001]

AlphaFold

O35714

Predicted Effect

probably benign
Transcript: ENSMUST00000040274

SMART Domains

Protein: ENSMUSP00000040035
Gene: ENSMUSG00000041954

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:TNFR	29	62	2e-6	BLAST
EGF	76	117	2.29e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000103173

SMART Domains

Protein: ENSMUSP00000099462
Gene: ENSMUSG00000041954

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	62	100	2.92e1	SMART
EGF	76	117	2.29e1	SMART
TNFR	103	141	5.56e-3	SMART
transmembrane domain	156	178	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122001
AA Change: G189D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113277
Gene: ENSMUSG00000041954
AA Change: G189D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	62	100	2.92e1	SMART
EGF	76	117	2.29e1	SMART
TNFR	103	141	5.56e-3	SMART
transmembrane domain	156	178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125100

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141260

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151836

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181389

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF-receptor superfamily. The encoded receptor has been shown to have increased expression upon T-cell activation, and it is thought to play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. Knockout studies in mice also suggest the role of this receptor is in the regulation of CD3-driven T-cell activation and programmed cell death. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a targeted mutation display dysregulation of T-cell receptor/CD3-driven T-cell activation and programmed cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Tnfrsf18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Tnfrsf18	APN	4	156028036	nonsense	probably null
R0100:Tnfrsf18	UTSW	4	156028366	missense	probably benign	0.15
R0100:Tnfrsf18	UTSW	4	156028366	missense	probably benign	0.15
R0311:Tnfrsf18	UTSW	4	156026415	missense	possibly damaging	0.95
R0624:Tnfrsf18	UTSW	4	156026529	missense	possibly damaging	0.94
R1158:Tnfrsf18	UTSW	4	156028282	missense	probably benign	0.29
R2117:Tnfrsf18	UTSW	4	156028516	missense	probably damaging	0.99
R2909:Tnfrsf18	UTSW	4	156028270	missense	probably damaging	1.00
R4610:Tnfrsf18	UTSW	4	156021880	unclassified	probably benign
R6571:Tnfrsf18	UTSW	4	156028319	nonsense	probably null
R7111:Tnfrsf18	UTSW	4	156028711	missense	probably damaging	0.97
R8058:Tnfrsf18	UTSW	4	156028345	missense	probably benign	0.29
R9376:Tnfrsf18	UTSW	4	156027991	missense	probably benign	0.15
R9573:Tnfrsf18	UTSW	4	156028027	missense	possibly damaging	0.95
R9609:Tnfrsf18	UTSW	4	156028751	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GGGAACAAGACCCACAATGCTG -3'
(R):5'- CAAGTCTTGTAGCGTCTGGC -3'

Sequencing Primer
(F):5'- TGTGTGCATCCCGGAGC -3'
(R):5'- GGAAGACCAGGCCTCATG -3'

Posted On

2016-07-22