Incidental Mutation 'R5307:Corin'
ID 404627
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Name corin, serine peptidase
Synonyms Lrp4
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 72457368-72661816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 72514321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 318 (G318C)
Ref Sequence ENSEMBL: ENSMUSP00000135511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
AlphaFold Q9Z319
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: G451C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: G451C

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167460
AA Change: G385C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: G385C

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175766
AA Change: G310C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: G310C

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176439
Predicted Effect probably damaging
Transcript: ENSMUST00000176974
AA Change: G348C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: G348C

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177290
AA Change: G318C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: G318C

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72,462,231 (GRCm39) missense probably damaging 1.00
IGL01114:Corin APN 5 72,462,354 (GRCm39) missense probably damaging 1.00
IGL01351:Corin APN 5 72,496,334 (GRCm39) missense probably damaging 1.00
IGL01516:Corin APN 5 72,611,830 (GRCm39) nonsense probably null
IGL01785:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01786:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01845:Corin APN 5 72,511,282 (GRCm39) missense probably damaging 1.00
IGL02097:Corin APN 5 72,529,489 (GRCm39) missense probably damaging 1.00
IGL02629:Corin APN 5 72,490,016 (GRCm39) missense probably damaging 1.00
IGL03085:Corin APN 5 72,511,273 (GRCm39) missense probably damaging 1.00
IGL03120:Corin APN 5 72,518,032 (GRCm39) missense probably damaging 1.00
IGL03150:Corin APN 5 72,460,201 (GRCm39) missense probably damaging 1.00
IGL03183:Corin APN 5 72,458,929 (GRCm39) missense probably damaging 0.99
IGL03185:Corin APN 5 72,490,124 (GRCm39) missense probably damaging 1.00
IGL03408:Corin APN 5 72,500,304 (GRCm39) missense probably benign 0.40
alpaca UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R0078:Corin UTSW 5 72,611,816 (GRCm39) missense possibly damaging 0.77
R0724:Corin UTSW 5 72,490,138 (GRCm39) splice site probably benign
R1065:Corin UTSW 5 72,458,993 (GRCm39) nonsense probably null
R1301:Corin UTSW 5 72,462,276 (GRCm39) missense possibly damaging 0.81
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1520:Corin UTSW 5 72,488,238 (GRCm39) missense probably damaging 1.00
R1584:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1617:Corin UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R1912:Corin UTSW 5 72,515,746 (GRCm39) missense probably damaging 1.00
R2059:Corin UTSW 5 72,473,394 (GRCm39) missense possibly damaging 0.76
R2173:Corin UTSW 5 72,661,422 (GRCm39) missense probably benign 0.01
R2242:Corin UTSW 5 72,490,054 (GRCm39) missense probably damaging 1.00
R2373:Corin UTSW 5 72,496,381 (GRCm39) missense probably damaging 1.00
R2850:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R3683:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3684:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3790:Corin UTSW 5 72,592,641 (GRCm39) missense probably benign 0.38
R3847:Corin UTSW 5 72,579,508 (GRCm39) missense probably benign 0.13
R3926:Corin UTSW 5 72,529,473 (GRCm39) missense probably damaging 1.00
R3939:Corin UTSW 5 72,497,222 (GRCm39) missense possibly damaging 0.80
R3945:Corin UTSW 5 72,515,767 (GRCm39) missense probably damaging 1.00
R4079:Corin UTSW 5 72,661,226 (GRCm39) missense probably benign 0.03
R4224:Corin UTSW 5 72,500,451 (GRCm39) missense probably damaging 1.00
R4473:Corin UTSW 5 72,496,400 (GRCm39) missense probably damaging 1.00
R4585:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4586:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4849:Corin UTSW 5 72,460,178 (GRCm39) missense probably damaging 1.00
R4926:Corin UTSW 5 72,529,525 (GRCm39) missense probably damaging 1.00
R5080:Corin UTSW 5 72,511,194 (GRCm39) intron probably benign
R5138:Corin UTSW 5 72,496,402 (GRCm39) missense probably damaging 1.00
R5262:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R5268:Corin UTSW 5 72,500,362 (GRCm39) missense probably damaging 1.00
R5302:Corin UTSW 5 72,473,441 (GRCm39) missense probably benign 0.07
R5324:Corin UTSW 5 72,592,600 (GRCm39) missense probably damaging 1.00
R5352:Corin UTSW 5 72,462,376 (GRCm39) missense probably benign 0.04
R5373:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5374:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5484:Corin UTSW 5 72,515,827 (GRCm39) missense probably benign 0.15
R5502:Corin UTSW 5 72,473,449 (GRCm39) nonsense probably null
R5544:Corin UTSW 5 72,462,357 (GRCm39) nonsense probably null
R5682:Corin UTSW 5 72,579,497 (GRCm39) missense possibly damaging 0.85
R5818:Corin UTSW 5 72,592,738 (GRCm39) missense probably benign 0.00
R5992:Corin UTSW 5 72,473,732 (GRCm39) missense probably benign 0.01
R6115:Corin UTSW 5 72,518,072 (GRCm39) missense probably damaging 1.00
R6181:Corin UTSW 5 72,529,439 (GRCm39) critical splice donor site probably null
R6317:Corin UTSW 5 72,496,388 (GRCm39) missense probably damaging 1.00
R7053:Corin UTSW 5 72,458,870 (GRCm39) missense probably benign 0.28
R7242:Corin UTSW 5 72,462,398 (GRCm39) missense probably benign 0.14
R7452:Corin UTSW 5 72,592,590 (GRCm39) missense possibly damaging 0.94
R7783:Corin UTSW 5 72,458,967 (GRCm39) missense probably benign 0.26
R7903:Corin UTSW 5 72,458,843 (GRCm39) missense probably benign 0.00
R7956:Corin UTSW 5 72,579,530 (GRCm39) missense probably damaging 0.99
R8007:Corin UTSW 5 72,473,446 (GRCm39) missense probably damaging 0.96
R8125:Corin UTSW 5 72,515,806 (GRCm39) missense probably damaging 0.96
R8215:Corin UTSW 5 72,462,361 (GRCm39) missense probably damaging 1.00
R8251:Corin UTSW 5 72,514,269 (GRCm39) missense probably damaging 1.00
R8364:Corin UTSW 5 72,462,274 (GRCm39) missense probably benign
R8505:Corin UTSW 5 72,592,750 (GRCm39) missense probably benign 0.21
R8746:Corin UTSW 5 72,592,695 (GRCm39) missense probably benign 0.31
R8887:Corin UTSW 5 72,486,953 (GRCm39) critical splice donor site probably null
R9484:Corin UTSW 5 72,497,280 (GRCm39) missense probably damaging 1.00
R9640:Corin UTSW 5 72,592,597 (GRCm39) missense probably benign
Z1177:Corin UTSW 5 72,611,836 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGACTATCCTGGGGACACTG -3'
(R):5'- AGCACTCAGTTCTTCCTAAGTGC -3'

Sequencing Primer
(F):5'- GACACTGGGGGCACTGG -3'
(R):5'- CCTAAGTGCTCTTTCACAATGAAGAG -3'
Posted On 2016-07-22