Incidental Mutation 'R0009:Magi2'
ID40463
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission 038304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0009 (G1)
Quality Score200
Status Validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20611055 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 747 (Y747F)
Ref Sequence ENSEMBL: ENSMUSP00000146769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443] [ENSMUST00000197553] [ENSMUST00000208219]
Predicted Effect probably benign
Transcript: ENSMUST00000088516
AA Change: Y1137F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003
AA Change: Y1137F

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101558
AA Change: Y960F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003
AA Change: Y960F

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115267
AA Change: Y974F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003
AA Change: Y974F

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197354
AA Change: Y1137F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: Y1137F

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197443
AA Change: Y1123F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: Y1123F

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197553
AA Change: Y747F

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect unknown
Transcript: ENSMUST00000199514
AA Change: Y77F
Predicted Effect probably benign
Transcript: ENSMUST00000208219
AA Change: Y731F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0362:Magi2 UTSW 5 19227575 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1103:Magi2 UTSW 5 20611103 missense probably damaging 1.00
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1847:Magi2 UTSW 5 20602460 missense probably damaging 0.99
R2223:Magi2 UTSW 5 20465672 missense probably damaging 1.00
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3694:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20702397 missense probably benign 0.00
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
R7605:Magi2 UTSW 5 20228385 missense probably damaging 1.00
R7712:Magi2 UTSW 5 20550282 missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20465840 missense probably benign 0.03
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Z1176:Magi2 UTSW 5 20702109 missense probably benign 0.32
Z1177:Magi2 UTSW 5 20702412 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGACCTACTTGAGCCTTTGGAGC -3'
(R):5'- TTGTCTGAGAGCACGCCTTAGC -3'

Sequencing Primer
(F):5'- AGCCTTTGGAGCTATGCC -3'
(R):5'- AGAGCACGCCTTAGCATCTTC -3'
Posted On2013-05-23