Mutagenetix > Incidental Mutations

Incidental Mutation 'R5307:Ephb4'

404630

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

042890-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 137363312 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 526 (T526A)

Ref Sequence

ENSEMBL: ENSMUSP00000130275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061244
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: T526A

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111054
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: T526A

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111055
AA Change: T535A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: T535A

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144296
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: T526A

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166239
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: T526A

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGAATCTTACGGCCCATTCC -3'
(R):5'- TGCTCATCTTACTGGAGGAGG -3'

Sequencing Primer
(F):5'- GAATCTTACGGCCCATTCCTTTCTC -3'
(R):5'- CTTGTGGGTCAACATGCAGC -3'

Posted On

2016-07-22