Incidental Mutation 'R5307:Ephb4'
ID 404630
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, b2b2412Clo, Myk1, Tyro11
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 137348371-137372784 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137361574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 526 (T526A)
Ref Sequence ENSEMBL: ENSMUSP00000130275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: T526A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: T526A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: T535A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: T535A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: T526A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: T526A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: T526A

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137,363,877 (GRCm39) splice site probably benign
IGL00948:Ephb4 APN 5 137,364,921 (GRCm39) missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137,364,003 (GRCm39) splice site probably benign
IGL01885:Ephb4 APN 5 137,356,059 (GRCm39) missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137,359,456 (GRCm39) missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137,369,024 (GRCm39) missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137,370,332 (GRCm39) missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137,352,763 (GRCm39) nonsense probably null
IGL03080:Ephb4 APN 5 137,352,345 (GRCm39) splice site probably benign
IGL03111:Ephb4 APN 5 137,370,767 (GRCm39) missense probably benign 0.07
R0599:Ephb4 UTSW 5 137,368,117 (GRCm39) missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137,363,929 (GRCm39) missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137,364,796 (GRCm39) splice site probably benign
R1441:Ephb4 UTSW 5 137,359,509 (GRCm39) missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137,370,440 (GRCm39) missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137,358,696 (GRCm39) missense probably benign
R1831:Ephb4 UTSW 5 137,352,677 (GRCm39) missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137,361,572 (GRCm39) missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137,352,688 (GRCm39) missense probably benign 0.08
R2206:Ephb4 UTSW 5 137,355,981 (GRCm39) missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137,363,962 (GRCm39) missense probably benign 0.15
R4779:Ephb4 UTSW 5 137,363,964 (GRCm39) missense probably benign 0.04
R4801:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137,359,404 (GRCm39) missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137,368,114 (GRCm39) missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137,352,701 (GRCm39) missense probably benign 0.00
R5662:Ephb4 UTSW 5 137,370,457 (GRCm39) missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137,358,678 (GRCm39) missense probably benign 0.00
R6336:Ephb4 UTSW 5 137,370,347 (GRCm39) missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137,358,711 (GRCm39) missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137,364,849 (GRCm39) missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137,368,066 (GRCm39) missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137,359,536 (GRCm39) missense probably benign 0.00
R7145:Ephb4 UTSW 5 137,370,308 (GRCm39) missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137,352,687 (GRCm39) missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137,359,560 (GRCm39) missense probably benign
R7635:Ephb4 UTSW 5 137,370,365 (GRCm39) missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137,363,937 (GRCm39) missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137,370,699 (GRCm39) missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137,356,117 (GRCm39) missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137,369,067 (GRCm39) missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137,352,824 (GRCm39) missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137,361,529 (GRCm39) missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137,361,564 (GRCm39) missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137,371,820 (GRCm39) missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137,359,621 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAATCTTACGGCCCATTCC -3'
(R):5'- TGCTCATCTTACTGGAGGAGG -3'

Sequencing Primer
(F):5'- GAATCTTACGGCCCATTCCTTTCTC -3'
(R):5'- CTTGTGGGTCAACATGCAGC -3'
Posted On 2016-07-22