Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Gcfc2'

404633

Institutional Source

Beutler Lab

Gene Symbol

Gcfc2

Ensembl Gene

ENSMUSG00000035125

Gene Name

GC-rich sequence DNA binding factor 2

Synonyms

AW146020

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.435) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81923669-81959915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81944386 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 458 (N458D)

Ref Sequence

ENSEMBL: ENSMUSP00000035644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]

AlphaFold

Q8BKT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043195
AA Change: N458D

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: N458D

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC
coiled coil region	255	308	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
Pfam:GCFC	456	672	3e-34	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127949

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132301

Predicted Effect

probably benign
Transcript: ENSMUST00000152996

SMART Domains

Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

Domain	Start	End	E-Value	Type
low complexity region	16	24	N/A	INTRINSIC
low complexity region	43	66	N/A	INTRINSIC
low complexity region	97	111	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	193	210	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203959

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Gcfc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Gcfc2	APN	6	81936015	missense	probably damaging	0.99
IGL00473:Gcfc2	APN	6	81944374	missense	probably damaging	1.00
IGL00497:Gcfc2	APN	6	81957970	missense	probably benign	0.08
IGL02135:Gcfc2	APN	6	81941400	missense	probably damaging	1.00
R0138:Gcfc2	UTSW	6	81949954	missense	probably damaging	1.00
R0208:Gcfc2	UTSW	6	81943463	missense	probably null	0.91
R0467:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R1105:Gcfc2	UTSW	6	81939453	missense	probably damaging	1.00
R1521:Gcfc2	UTSW	6	81923812	missense	probably benign	0.14
R1602:Gcfc2	UTSW	6	81944420	missense	probably damaging	1.00
R1846:Gcfc2	UTSW	6	81956892	missense	probably damaging	0.99
R2091:Gcfc2	UTSW	6	81943479	missense	probably damaging	1.00
R2110:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2111:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2112:Gcfc2	UTSW	6	81923778	missense	probably benign	0.01
R2892:Gcfc2	UTSW	6	81956913	missense	possibly damaging	0.87
R3792:Gcfc2	UTSW	6	81930767	missense	probably benign	0.00
R4284:Gcfc2	UTSW	6	81941391	missense	probably damaging	1.00
R4304:Gcfc2	UTSW	6	81943007	missense	probably damaging	1.00
R4691:Gcfc2	UTSW	6	81941427	nonsense	probably null
R5046:Gcfc2	UTSW	6	81948335	missense	probably benign	0.12
R5233:Gcfc2	UTSW	6	81953290	missense	probably damaging	1.00
R5308:Gcfc2	UTSW	6	81943543	critical splice donor site	probably null
R5929:Gcfc2	UTSW	6	81946599	missense	probably damaging	1.00
R6339:Gcfc2	UTSW	6	81946496	missense	probably damaging	1.00
R6485:Gcfc2	UTSW	6	81939547	missense	probably damaging	1.00
R6931:Gcfc2	UTSW	6	81942985	missense	probably benign	0.36
R6948:Gcfc2	UTSW	6	81933753	missense	probably benign	0.01
R7392:Gcfc2	UTSW	6	81943012	critical splice donor site	probably null
R7423:Gcfc2	UTSW	6	81946560	missense	probably damaging	1.00
R7509:Gcfc2	UTSW	6	81953275	missense	probably damaging	1.00
R7713:Gcfc2	UTSW	6	81941390	missense	probably damaging	1.00
R8089:Gcfc2	UTSW	6	81925790	missense	probably damaging	1.00
R8249:Gcfc2	UTSW	6	81956951	missense	probably benign	0.02
R8366:Gcfc2	UTSW	6	81923801	missense	probably benign	0.05
R8553:Gcfc2	UTSW	6	81935963	missense	probably benign	0.01
R8560:Gcfc2	UTSW	6	81923882	missense	possibly damaging	0.56
R8779:Gcfc2	UTSW	6	81948317	missense	probably benign	0.00
R8915:Gcfc2	UTSW	6	81941366	missense	probably benign	0.36
R8924:Gcfc2	UTSW	6	81932898	missense	probably damaging	1.00
R9687:Gcfc2	UTSW	6	81941342	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACAGGAACTCAATACACAGTAGG -3'
(R):5'- GCAGTTGACATGACCAGGAC -3'

Sequencing Primer
(F):5'- CGTGACTGTTGGTAAGGA -3'
(R):5'- TTGACATGACCAGGACAGTCACATG -3'

Posted On

2016-07-22