Incidental Mutation 'R5307:Leng8'
ID 404637
Institutional Source Beutler Lab
Gene Symbol Leng8
Ensembl Gene ENSMUSG00000035545
Gene Name leukocyte receptor cluster (LRC) member 8
Synonyms
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 4140038-4151176 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4148472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 748 (T748I)
Ref Sequence ENSEMBL: ENSMUSP00000112428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037472] [ENSMUST00000058358] [ENSMUST00000121270] [ENSMUST00000128756] [ENSMUST00000144248] [ENSMUST00000154571]
AlphaFold Q8CBY3
Predicted Effect probably damaging
Transcript: ENSMUST00000037472
AA Change: T748M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046465
Gene: ENSMUSG00000035545
AA Change: T748M

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 762 8.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058358
SMART Domains Protein: ENSMUSP00000061079
Gene: ENSMUSG00000043432

DomainStartEndE-ValueType
ZnF_C3H1 8 34 1.72e-4 SMART
Pfam:DUF504 77 128 1.9e-11 PFAM
Pfam:AKAP7_NLS 305 484 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121270
AA Change: T748I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112428
Gene: ENSMUSG00000035545
AA Change: T748I

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
Pfam:SAC3_GANP 567 764 7.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127723
Predicted Effect probably benign
Transcript: ENSMUST00000128756
SMART Domains Protein: ENSMUSP00000118832
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144248
SMART Domains Protein: ENSMUSP00000120574
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 346 359 N/A INTRINSIC
low complexity region 376 410 N/A INTRINSIC
low complexity region 416 431 N/A INTRINSIC
Pfam:SAC3_GANP 530 725 1e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146434
Predicted Effect probably benign
Transcript: ENSMUST00000154571
SMART Domains Protein: ENSMUSP00000123328
Gene: ENSMUSG00000035545

DomainStartEndE-ValueType
low complexity region 47 69 N/A INTRINSIC
low complexity region 73 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155881
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Leng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Leng8 APN 7 4,148,481 (GRCm39) missense probably benign 0.03
IGL02437:Leng8 APN 7 4,145,092 (GRCm39) missense probably damaging 0.99
Coolhand UTSW 7 4,147,932 (GRCm39) nonsense probably null
R0104:Leng8 UTSW 7 4,146,807 (GRCm39) missense probably damaging 0.99
R0774:Leng8 UTSW 7 4,145,135 (GRCm39) missense probably damaging 1.00
R1696:Leng8 UTSW 7 4,148,135 (GRCm39) missense probably damaging 1.00
R2001:Leng8 UTSW 7 4,148,073 (GRCm39) missense probably damaging 1.00
R2012:Leng8 UTSW 7 4,146,609 (GRCm39) missense probably damaging 1.00
R2054:Leng8 UTSW 7 4,147,289 (GRCm39) nonsense probably null
R3433:Leng8 UTSW 7 4,145,131 (GRCm39) missense probably benign 0.22
R4335:Leng8 UTSW 7 4,150,037 (GRCm39) missense probably damaging 0.99
R4607:Leng8 UTSW 7 4,147,796 (GRCm39) missense probably damaging 1.00
R4608:Leng8 UTSW 7 4,147,796 (GRCm39) missense probably damaging 1.00
R4886:Leng8 UTSW 7 4,147,930 (GRCm39) splice site probably null
R5339:Leng8 UTSW 7 4,148,285 (GRCm39) missense possibly damaging 0.96
R5368:Leng8 UTSW 7 4,142,987 (GRCm39) missense probably damaging 0.97
R5370:Leng8 UTSW 7 4,148,433 (GRCm39) missense possibly damaging 0.48
R5615:Leng8 UTSW 7 4,147,957 (GRCm39) nonsense probably null
R5645:Leng8 UTSW 7 4,148,273 (GRCm39) missense probably damaging 1.00
R5750:Leng8 UTSW 7 4,145,119 (GRCm39) missense probably benign 0.04
R6041:Leng8 UTSW 7 4,148,568 (GRCm39) missense probably benign 0.01
R6054:Leng8 UTSW 7 4,148,522 (GRCm39) splice site probably null
R6481:Leng8 UTSW 7 4,148,412 (GRCm39) missense probably damaging 1.00
R6826:Leng8 UTSW 7 4,148,319 (GRCm39) missense probably damaging 1.00
R6919:Leng8 UTSW 7 4,146,625 (GRCm39) missense possibly damaging 0.82
R7313:Leng8 UTSW 7 4,142,525 (GRCm39) missense possibly damaging 0.73
R7357:Leng8 UTSW 7 4,147,932 (GRCm39) nonsense probably null
R7428:Leng8 UTSW 7 4,146,572 (GRCm39) missense probably damaging 1.00
R7686:Leng8 UTSW 7 4,146,504 (GRCm39) nonsense probably null
R8027:Leng8 UTSW 7 4,145,855 (GRCm39) frame shift probably null
R8198:Leng8 UTSW 7 4,147,170 (GRCm39) missense possibly damaging 0.82
R9048:Leng8 UTSW 7 4,146,931 (GRCm39) unclassified probably benign
R9103:Leng8 UTSW 7 4,146,897 (GRCm39) missense probably damaging 1.00
R9234:Leng8 UTSW 7 4,145,247 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACGGAACTGGCATACCTCAC -3'
(R):5'- ACATGATGCCAGGAGTGGTG -3'

Sequencing Primer
(F):5'- CCTCACAAGGGAGATGAAGGC -3'
(R):5'- TGGTGAGGCCAGAACAGTG -3'
Posted On 2016-07-22