Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Kmt2b'

404638

Institutional Source

Beutler Lab

Gene Symbol

Kmt2b

Ensembl Gene

ENSMUSG00000006307

Gene Name

lysine (K)-specific methyltransferase 2B

Synonyms

2610014H22Rik, Wbp7, Mll2

MMRRC Submission

042890-MU

Accession Numbers

Genbank: NM_029274; MGI: 109565

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5307 (G1)

Quality Score

204

Status

Not validated

Chromosome

Chromosomal Location

30568858-30588726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30581673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1294 (A1294T)

Ref Sequence

ENSEMBL: ENSMUSP00000103789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006470
AA Change: A1294T

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: A1294T

Domain	Start	End	E-Value	Type
AT_hook	18	30	2.82e2	SMART
low complexity region	66	106	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
AT_hook	149	159	2.4e2	SMART
AT_hook	218	230	1.95e2	SMART
low complexity region	249	263	N/A	INTRINSIC
low complexity region	272	302	N/A	INTRINSIC
coiled coil region	353	413	N/A	INTRINSIC
AT_hook	476	488	5.47e-1	SMART
low complexity region	501	517	N/A	INTRINSIC
low complexity region	578	606	N/A	INTRINSIC
low complexity region	621	657	N/A	INTRINSIC
low complexity region	673	700	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
low complexity region	738	777	N/A	INTRINSIC
low complexity region	910	922	N/A	INTRINSIC
Pfam:zf-CXXC	963	1010	7.2e-15	PFAM
low complexity region	1039	1061	N/A	INTRINSIC
low complexity region	1103	1115	N/A	INTRINSIC
PHD	1209	1256	1.25e-5	SMART
PHD	1257	1307	5.4e-10	SMART
PHD	1343	1400	1.27e-6	SMART
low complexity region	1415	1427	N/A	INTRINSIC
PHD	1646	1692	3.82e-1	SMART
FYRN	1745	1788	3.25e-19	SMART
low complexity region	1881	1899	N/A	INTRINSIC
low complexity region	1912	1942	N/A	INTRINSIC
low complexity region	1961	1978	N/A	INTRINSIC
low complexity region	1991	2003	N/A	INTRINSIC
low complexity region	2013	2026	N/A	INTRINSIC
low complexity region	2048	2061	N/A	INTRINSIC
low complexity region	2087	2105	N/A	INTRINSIC
low complexity region	2127	2138	N/A	INTRINSIC
low complexity region	2215	2235	N/A	INTRINSIC
low complexity region	2239	2270	N/A	INTRINSIC
low complexity region	2396	2406	N/A	INTRINSIC
FYRC	2419	2504	4.83e-36	SMART
SET	2581	2703	1.67e-42	SMART
PostSET	2705	2721	4.65e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108154
AA Change: A1294T

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: A1294T

Domain	Start	End	E-Value	Type
AT_hook	18	30	2.82e2	SMART
low complexity region	66	106	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
AT_hook	149	159	2.4e2	SMART
AT_hook	218	230	1.95e2	SMART
low complexity region	249	263	N/A	INTRINSIC
low complexity region	272	302	N/A	INTRINSIC
coiled coil region	353	413	N/A	INTRINSIC
AT_hook	476	488	5.47e-1	SMART
low complexity region	501	517	N/A	INTRINSIC
low complexity region	578	606	N/A	INTRINSIC
low complexity region	621	657	N/A	INTRINSIC
low complexity region	673	700	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
low complexity region	738	777	N/A	INTRINSIC
low complexity region	910	922	N/A	INTRINSIC
Pfam:zf-CXXC	963	1010	1e-14	PFAM
low complexity region	1039	1061	N/A	INTRINSIC
low complexity region	1103	1115	N/A	INTRINSIC
PHD	1209	1256	1.25e-5	SMART
PHD	1257	1307	5.4e-10	SMART
PHD	1343	1400	1.27e-6	SMART
low complexity region	1415	1427	N/A	INTRINSIC
PHD	1646	1692	3.82e-1	SMART
FYRN	1745	1788	3.25e-19	SMART
low complexity region	1872	1890	N/A	INTRINSIC
low complexity region	1903	1933	N/A	INTRINSIC
low complexity region	1952	1969	N/A	INTRINSIC
low complexity region	1982	1994	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2039	2052	N/A	INTRINSIC
low complexity region	2078	2096	N/A	INTRINSIC
low complexity region	2118	2129	N/A	INTRINSIC
low complexity region	2206	2226	N/A	INTRINSIC
low complexity region	2230	2261	N/A	INTRINSIC
low complexity region	2383	2398	N/A	INTRINSIC
FYRC	2411	2496	4.83e-36	SMART
SET	2573	2695	1.67e-42	SMART
PostSET	2697	2713	4.65e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125836

Predicted Effect

unknown
Transcript: ENSMUST00000131002
AA Change: A585T

SMART Domains

Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: A585T

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
low complexity region	30	69	N/A	INTRINSIC
low complexity region	202	214	N/A	INTRINSIC
Pfam:zf-CXXC	255	302	5.2e-15	PFAM
low complexity region	331	353	N/A	INTRINSIC
low complexity region	395	407	N/A	INTRINSIC
PHD	501	548	1.25e-5	SMART
PHD	549	599	5.4e-10	SMART
PHD	635	692	1.27e-6	SMART
low complexity region	707	719	N/A	INTRINSIC
PHD	938	984	3.82e-1	SMART
FYRN	1037	1080	3.25e-19	SMART
low complexity region	1173	1191	N/A	INTRINSIC
low complexity region	1204	1234	N/A	INTRINSIC
low complexity region	1253	1270	N/A	INTRINSIC
low complexity region	1283	1295	N/A	INTRINSIC
low complexity region	1305	1318	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1379	1397	N/A	INTRINSIC
low complexity region	1419	1430	N/A	INTRINSIC
low complexity region	1507	1527	N/A	INTRINSIC
low complexity region	1531	1562	N/A	INTRINSIC
low complexity region	1684	1699	N/A	INTRINSIC
FYRC	1712	1797	4.83e-36	SMART
SET	1874	1996	1.67e-42	SMART
PostSET	1998	2014	4.65e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152931

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Kmt2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Kmt2b	APN	7	30586513	unclassified	probably benign
IGL00821:Kmt2b	APN	7	30570613	missense	probably damaging	1.00
IGL00985:Kmt2b	APN	7	30579927	missense	probably damaging	1.00
IGL01092:Kmt2b	APN	7	30580507	missense	probably damaging	1.00
IGL01933:Kmt2b	APN	7	30569514	critical splice donor site	probably null
IGL01949:Kmt2b	APN	7	30577161	splice site	probably null
IGL02253:Kmt2b	APN	7	30581727	missense	probably damaging	1.00
IGL02455:Kmt2b	APN	7	30578878	critical splice donor site	probably null
IGL02493:Kmt2b	APN	7	30569511	unclassified	probably benign
IGL02504:Kmt2b	APN	7	30586543	unclassified	probably benign
IGL02532:Kmt2b	APN	7	30586889	unclassified	probably benign
IGL02698:Kmt2b	APN	7	30578693	splice site	probably benign
IGL02717:Kmt2b	APN	7	30583444	missense	probably damaging	1.00
IGL02826:Kmt2b	APN	7	30577144	missense	probably damaging	1.00
IGL02966:Kmt2b	APN	7	30575462	missense	probably benign	0.02
IGL03386:Kmt2b	APN	7	30573971	missense	possibly damaging	0.94
Dean	UTSW	7	30569410	missense	possibly damaging	0.83
provost	UTSW	7	30582208	missense	probably damaging	1.00
tenure	UTSW	7	30569175	missense	probably damaging	1.00
3-1:Kmt2b	UTSW	7	30569615	nonsense	probably null
FR4304:Kmt2b	UTSW	7	30586363	unclassified	probably benign
FR4340:Kmt2b	UTSW	7	30586363	unclassified	probably benign
FR4340:Kmt2b	UTSW	7	30586369	unclassified	probably benign
FR4340:Kmt2b	UTSW	7	30586375	unclassified	probably benign
FR4342:Kmt2b	UTSW	7	30586375	unclassified	probably benign
FR4449:Kmt2b	UTSW	7	30586361	unclassified	probably benign
FR4449:Kmt2b	UTSW	7	30586366	unclassified	probably benign
FR4449:Kmt2b	UTSW	7	30586369	unclassified	probably benign
FR4548:Kmt2b	UTSW	7	30586380	unclassified	probably benign
FR4589:Kmt2b	UTSW	7	30586361	unclassified	probably benign
FR4589:Kmt2b	UTSW	7	30586364	nonsense	probably null
FR4589:Kmt2b	UTSW	7	30586381	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586366	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586367	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586370	unclassified	probably benign
FR4737:Kmt2b	UTSW	7	30586378	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586360	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586362	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586373	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586366	unclassified	probably benign
FR4976:Kmt2b	UTSW	7	30586364	nonsense	probably null
PIT4403001:Kmt2b	UTSW	7	30585689	missense	probably damaging	1.00
PIT4802001:Kmt2b	UTSW	7	30579571	missense	probably damaging	0.99
R0057:Kmt2b	UTSW	7	30576792	splice site	probably benign
R0131:Kmt2b	UTSW	7	30583921	missense	probably damaging	0.99
R0241:Kmt2b	UTSW	7	30577069	missense	probably damaging	1.00
R0241:Kmt2b	UTSW	7	30577069	missense	probably damaging	1.00
R0377:Kmt2b	UTSW	7	30574193	missense	probably damaging	1.00
R0396:Kmt2b	UTSW	7	30576755	missense	probably damaging	1.00
R1241:Kmt2b	UTSW	7	30574940	missense	probably damaging	0.98
R1252:Kmt2b	UTSW	7	30580487	missense	probably damaging	0.99
R1418:Kmt2b	UTSW	7	30576960	splice site	probably benign
R1599:Kmt2b	UTSW	7	30570575	missense	probably damaging	1.00
R1632:Kmt2b	UTSW	7	30583962	missense	probably damaging	1.00
R1745:Kmt2b	UTSW	7	30585850	missense	possibly damaging	0.90
R1867:Kmt2b	UTSW	7	30574658	missense	possibly damaging	0.71
R1955:Kmt2b	UTSW	7	30575351	missense	possibly damaging	0.90
R2040:Kmt2b	UTSW	7	30569420	missense	probably damaging	1.00
R2113:Kmt2b	UTSW	7	30583387	missense	probably damaging	1.00
R2216:Kmt2b	UTSW	7	30574065	missense	probably benign	0.25
R2401:Kmt2b	UTSW	7	30576708	missense	probably damaging	1.00
R2518:Kmt2b	UTSW	7	30576068	missense	probably benign	0.10
R3436:Kmt2b	UTSW	7	30576692	missense	probably damaging	1.00
R4248:Kmt2b	UTSW	7	30574064	missense	probably benign	0.25
R4259:Kmt2b	UTSW	7	30581081	missense	probably damaging	0.99
R4290:Kmt2b	UTSW	7	30581836	critical splice donor site	probably null
R4388:Kmt2b	UTSW	7	30588590	unclassified	probably benign
R4542:Kmt2b	UTSW	7	30580259	missense	probably damaging	0.99
R4649:Kmt2b	UTSW	7	30586358	unclassified	probably benign
R4722:Kmt2b	UTSW	7	30583202	missense	probably damaging	1.00
R4891:Kmt2b	UTSW	7	30576761	nonsense	probably null
R4916:Kmt2b	UTSW	7	30578517	missense	probably damaging	0.99
R5104:Kmt2b	UTSW	7	30569840	missense	probably damaging	1.00
R5254:Kmt2b	UTSW	7	30569175	missense	probably damaging	1.00
R5262:Kmt2b	UTSW	7	30569794	missense	probably damaging	1.00
R5526:Kmt2b	UTSW	7	30580444	missense	probably damaging	1.00
R5609:Kmt2b	UTSW	7	30577145	missense	probably damaging	0.99
R6150:Kmt2b	UTSW	7	30588477	unclassified	probably benign
R6727:Kmt2b	UTSW	7	30584559	missense	probably damaging	0.98
R6824:Kmt2b	UTSW	7	30586276	unclassified	probably benign
R7048:Kmt2b	UTSW	7	30569306	missense	probably damaging	0.99
R7155:Kmt2b	UTSW	7	30579963	missense	probably damaging	0.99
R7307:Kmt2b	UTSW	7	30580471	missense	probably damaging	0.99
R7388:Kmt2b	UTSW	7	30581960	missense	probably damaging	1.00
R7555:Kmt2b	UTSW	7	30569410	missense	possibly damaging	0.83
R7569:Kmt2b	UTSW	7	30569553	missense	possibly damaging	0.54
R7616:Kmt2b	UTSW	7	30582208	missense	probably damaging	1.00
R7669:Kmt2b	UTSW	7	30583231	missense	possibly damaging	0.84
R7881:Kmt2b	UTSW	7	30579783	missense	probably damaging	1.00
R7999:Kmt2b	UTSW	7	30576774	missense	probably damaging	1.00
R8003:Kmt2b	UTSW	7	30569377	missense	probably damaging	0.98
R8189:Kmt2b	UTSW	7	30569331	missense	probably damaging	0.98
R8291:Kmt2b	UTSW	7	30585469	missense	probably damaging	1.00
R8314:Kmt2b	UTSW	7	30578922	missense	probably damaging	0.99
R8802:Kmt2b	UTSW	7	30584071	missense	probably damaging	1.00
R8954:Kmt2b	UTSW	7	30574215	missense	probably damaging	1.00
R9046:Kmt2b	UTSW	7	30586054	missense	probably benign	0.00
R9225:Kmt2b	UTSW	7	30586747	missense	unknown
R9258:Kmt2b	UTSW	7	30582468	missense	probably null	0.99
R9414:Kmt2b	UTSW	7	30582882	missense	probably damaging	0.99
R9468:Kmt2b	UTSW	7	30585088	missense	probably damaging	0.98
R9508:Kmt2b	UTSW	7	30569834	missense	probably damaging	0.99
R9642:Kmt2b	UTSW	7	30583915	critical splice donor site	probably null
R9667:Kmt2b	UTSW	7	30588359	missense	unknown
R9709:Kmt2b	UTSW	7	30579803	missense	probably damaging	0.98
RF001:Kmt2b	UTSW	7	30586382	unclassified	probably benign
RF006:Kmt2b	UTSW	7	30586377	unclassified	probably benign
RF020:Kmt2b	UTSW	7	30586382	unclassified	probably benign
RF021:Kmt2b	UTSW	7	30586357	unclassified	probably benign
RF030:Kmt2b	UTSW	7	30586377	unclassified	probably benign
RF035:Kmt2b	UTSW	7	30586357	unclassified	probably benign
X0067:Kmt2b	UTSW	7	30579573	missense	probably damaging	0.99
Z1088:Kmt2b	UTSW	7	30585251	missense	probably benign	0.28
Z1176:Kmt2b	UTSW	7	30577370	missense	probably damaging	1.00
Z1177:Kmt2b	UTSW	7	30575024	missense	probably benign	0.08
Z1177:Kmt2b	UTSW	7	30584163	missense	probably damaging	0.98
Z1177:Kmt2b	UTSW	7	30586416	missense	unknown
Z1186:Kmt2b	UTSW	7	30574979	missense	probably benign
Z1186:Kmt2b	UTSW	7	30585307	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGAGCTCCTAGAGACCACCTG -3'
(R):5'- TTGCCAAGTCTGCTGCGATC -3'

Sequencing Primer
(F):5'- GTCCACCTACAGCTTGCCTATG -3'
(R):5'- TCAGCATCGTGACACCTG -3'

Posted On

2016-07-22