Incidental Mutation 'R5307:Ddc'
ID 404653
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Name dopa decarboxylase
Synonyms Aadc, aromatic L-amino acid decarboxylase
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 11764101-11848144 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11826321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 80 (F80S)
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000155690] [ENSMUST00000178704]
AlphaFold O88533
Predicted Effect probably damaging
Transcript: ENSMUST00000066237
AA Change: F80S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182
AA Change: F80S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109659
AA Change: F80S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182
AA Change: F80S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151032
Predicted Effect probably damaging
Transcript: ENSMUST00000155690
AA Change: F80S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121096
Gene: ENSMUSG00000020182
AA Change: F80S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 253 9.1e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178704
AA Change: F80S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182
AA Change: F80S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Usp25 T A 16: 76,890,594 (GRCm39) D767E probably benign Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11,789,462 (GRCm39) missense probably damaging 1.00
IGL01336:Ddc APN 11 11,796,630 (GRCm39) splice site probably null
IGL02257:Ddc APN 11 11,823,171 (GRCm39) nonsense probably null
IGL02327:Ddc APN 11 11,813,739 (GRCm39) missense probably damaging 0.98
IGL02516:Ddc APN 11 11,779,125 (GRCm39) missense probably damaging 1.00
IGL02616:Ddc APN 11 11,830,645 (GRCm39) utr 5 prime probably benign
IGL02888:Ddc APN 11 11,772,297 (GRCm39) splice site probably benign
IGL03267:Ddc APN 11 11,826,303 (GRCm39) missense probably damaging 1.00
R0454:Ddc UTSW 11 11,830,587 (GRCm39) missense possibly damaging 0.88
R1061:Ddc UTSW 11 11,779,132 (GRCm39) missense probably benign 0.00
R1173:Ddc UTSW 11 11,796,634 (GRCm39) critical splice donor site probably null
R1382:Ddc UTSW 11 11,774,856 (GRCm39) missense possibly damaging 0.52
R1549:Ddc UTSW 11 11,796,656 (GRCm39) splice site probably null
R1583:Ddc UTSW 11 11,779,131 (GRCm39) missense probably benign 0.17
R1929:Ddc UTSW 11 11,785,764 (GRCm39) missense probably damaging 1.00
R1970:Ddc UTSW 11 11,765,292 (GRCm39) missense possibly damaging 0.87
R2034:Ddc UTSW 11 11,830,456 (GRCm39) missense probably benign 0.40
R2270:Ddc UTSW 11 11,785,764 (GRCm39) missense probably damaging 1.00
R2272:Ddc UTSW 11 11,785,764 (GRCm39) missense probably damaging 1.00
R4449:Ddc UTSW 11 11,785,802 (GRCm39) missense probably damaging 1.00
R4508:Ddc UTSW 11 11,769,393 (GRCm39) critical splice acceptor site probably null
R4799:Ddc UTSW 11 11,796,632 (GRCm39) splice site probably null
R6654:Ddc UTSW 11 11,830,452 (GRCm39) missense probably damaging 1.00
R6817:Ddc UTSW 11 11,774,854 (GRCm39) missense probably damaging 1.00
R6918:Ddc UTSW 11 11,769,307 (GRCm39) missense probably damaging 1.00
R7001:Ddc UTSW 11 11,774,870 (GRCm39) critical splice acceptor site probably null
R7784:Ddc UTSW 11 11,789,396 (GRCm39) critical splice donor site probably null
R8435:Ddc UTSW 11 11,814,902 (GRCm39) missense probably damaging 0.97
R8550:Ddc UTSW 11 11,785,743 (GRCm39) missense probably damaging 1.00
R9200:Ddc UTSW 11 11,765,388 (GRCm39) missense possibly damaging 0.81
R9303:Ddc UTSW 11 11,779,132 (GRCm39) missense probably benign 0.00
R9616:Ddc UTSW 11 11,772,288 (GRCm39) nonsense probably null
Z1177:Ddc UTSW 11 11,830,552 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACAGAGCCACCTGTTTC -3'
(R):5'- AGACAGCATTTCCTTCTTGACTAGC -3'

Sequencing Primer
(F):5'- CTGTCCTGTGTGCAAAGGGATC -3'
(R):5'- CTTGACTAGCAAAGATATTGAAGCAC -3'
Posted On 2016-07-22