Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Cntrob'

404656

Institutional Source

Beutler Lab

Gene Symbol

Cntrob

Ensembl Gene

ENSMUSG00000032782

Gene Name

centrobin, centrosomal BRCA2 interacting protein

Synonyms

Lip8, 9830165K03Rik

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69299487-69323775 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 69314750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 419 (R419S)

Ref Sequence

ENSEMBL: ENSMUSP00000090651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]

AlphaFold

Q8CB62

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092973
AA Change: R419S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: R419S

Domain	Start	End	E-Value	Type
coiled coil region	191	218	N/A	INTRINSIC
coiled coil region	249	557	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123176

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125777

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176111

Predicted Effect

probably benign
Transcript: ENSMUST00000176938

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Cntrob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02975:Cntrob	APN	11	69319373	missense	possibly damaging	0.66
IGL03173:Cntrob	APN	11	69310027	missense	possibly damaging	0.90
groats	UTSW	11	69309491	nonsense	probably null
BB005:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
BB015:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
R0270:Cntrob	UTSW	11	69311341	missense	possibly damaging	0.66
R0501:Cntrob	UTSW	11	69322868	missense	probably damaging	1.00
R1749:Cntrob	UTSW	11	69322874	missense	probably damaging	0.99
R1775:Cntrob	UTSW	11	69320867	missense	possibly damaging	0.90
R1900:Cntrob	UTSW	11	69308054	missense	probably benign	0.27
R1967:Cntrob	UTSW	11	69320963	missense	probably damaging	0.97
R2495:Cntrob	UTSW	11	69322923	missense	probably damaging	0.96
R3121:Cntrob	UTSW	11	69322700	nonsense	probably null
R3780:Cntrob	UTSW	11	69302882	missense	probably damaging	0.97
R4449:Cntrob	UTSW	11	69305549	missense	probably benign	0.29
R4696:Cntrob	UTSW	11	69320888	missense	probably damaging	1.00
R4841:Cntrob	UTSW	11	69315394	missense	possibly damaging	0.92
R4842:Cntrob	UTSW	11	69315394	missense	possibly damaging	0.92
R4908:Cntrob	UTSW	11	69320906	missense	probably damaging	0.97
R4982:Cntrob	UTSW	11	69311362	splice site	probably null
R5168:Cntrob	UTSW	11	69299990	missense	possibly damaging	0.66
R5187:Cntrob	UTSW	11	69321891	missense	possibly damaging	0.62
R5473:Cntrob	UTSW	11	69322753	missense	possibly damaging	0.81
R5903:Cntrob	UTSW	11	69309375	missense	possibly damaging	0.83
R6643:Cntrob	UTSW	11	69311422	missense	possibly damaging	0.46
R6742:Cntrob	UTSW	11	69322923	missense	probably damaging	0.96
R6964:Cntrob	UTSW	11	69309491	nonsense	probably null
R7020:Cntrob	UTSW	11	69303092	critical splice donor site	probably null
R7425:Cntrob	UTSW	11	69314734	nonsense	probably null
R7928:Cntrob	UTSW	11	69300295	missense	probably damaging	0.97
R7946:Cntrob	UTSW	11	69315221	missense	possibly damaging	0.82
R8348:Cntrob	UTSW	11	69299853	missense	unknown
R8448:Cntrob	UTSW	11	69299853	missense	unknown
R8539:Cntrob	UTSW	11	69320826	missense	possibly damaging	0.94
R9259:Cntrob	UTSW	11	69320839	missense	possibly damaging	0.81
R9415:Cntrob	UTSW	11	69302915	missense	possibly damaging	0.66
R9553:Cntrob	UTSW	11	69314853	missense	probably benign	0.00
R9626:Cntrob	UTSW	11	69311341	missense	possibly damaging	0.66
R9628:Cntrob	UTSW	11	69322956	missense	possibly damaging	0.66
R9801:Cntrob	UTSW	11	69321407	missense	possibly damaging	0.82
Z1177:Cntrob	UTSW	11	69311449	missense	possibly damaging	0.66
Z1186:Cntrob	UTSW	11	69305578	missense	probably benign
Z1186:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1187:Cntrob	UTSW	11	69305578	missense	probably benign
Z1187:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1188:Cntrob	UTSW	11	69305578	missense	probably benign
Z1188:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1189:Cntrob	UTSW	11	69305578	missense	probably benign
Z1189:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1190:Cntrob	UTSW	11	69305578	missense	probably benign
Z1190:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1191:Cntrob	UTSW	11	69305578	missense	probably benign
Z1191:Cntrob	UTSW	11	69308056	missense	probably benign	0.23
Z1192:Cntrob	UTSW	11	69305578	missense	probably benign
Z1192:Cntrob	UTSW	11	69308056	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GTCTAAATGTAACAGTGAGTCAACC -3'
(R):5'- GTGTGACGTGGATCAGTAGC -3'

Sequencing Primer
(F):5'- CACACTGTGGGAAAATGTCTTCAG -3'
(R):5'- TGGATCAGTAGCCGGGG -3'

Posted On

2016-07-22