Incidental Mutation 'R0009:Lep'
ID 40466
Institutional Source Beutler Lab
Gene Symbol Lep
Ensembl Gene ENSMUSG00000059201
Gene Name leptin
Synonyms ob
MMRRC Submission 038304-MU
Accession Numbers

Ncbi RefSeq: NM_008493.3; MGI:104663
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0009 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 29060220-29073877 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 29068972 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 7 (C7*)
Ref Sequence ENSEMBL: ENSMUSP00000130087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069789] [ENSMUST00000169505]
AlphaFold P41160
Predicted Effect probably null
Transcript: ENSMUST00000069789
AA Change: C7*
SMART Domains Protein: ENSMUSP00000067046
Gene: ENSMUSG00000059201
AA Change: C7*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Leptin 23 167 5.8e-71 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169505
AA Change: C7*
SMART Domains Protein: ENSMUSP00000130087
Gene: ENSMUSG00000059201
AA Change: C7*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Leptin 22 98 5.9e-50 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype Strain: 1856424
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes are obese, hyperphagic, have low activity, high metabolic efficiency, impaired thermogenesis, infertility and short lifespan in addition to varying other abnormalities. Strain background affects severity and course of diabetes. Heterozygotes survive fasting longer than control mice. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(2) Chemically induced(1)
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trappc11 A T 8: 47,503,320 C874S possibly damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Lep
AlleleSourceChrCoordTypePredicted EffectPPH Score
potbelly UTSW 6 29068972 nonsense probably null
potbelly2 UTSW 6 29069090 missense possibly damaging 0.95
R1190:Lep UTSW 6 29071174 nonsense probably null
R1545:Lep UTSW 6 29070832 missense probably damaging 1.00
R1585:Lep UTSW 6 29069090 missense possibly damaging 0.95
R5253:Lep UTSW 6 29070863 missense probably damaging 1.00
R9113:Lep UTSW 6 29071094 missense probably damaging 0.98
R9757:Lep UTSW 6 29069084 missense probably benign 0.07
Z1176:Lep UTSW 6 29070970 missense possibly damaging 0.50
Z1177:Lep UTSW 6 29071097 missense probably damaging 1.00
Z1177:Lep UTSW 6 29071096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTCCCAGGGGTACACATTTCAC -3'
(R):5'- CGATACTGGCAGTACAACTGAGCAG -3'

Sequencing Primer
(F):5'- CAGGGGTACACATTTCACTAATC -3'
(R):5'- CTGTATTTCAGCAGGCAGC -3'
Posted On 2013-05-23