Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Atg2b'

404664

Institutional Source

Beutler Lab

Gene Symbol

Atg2b

Ensembl Gene

ENSMUSG00000041341

Gene Name

autophagy related 2B

Synonyms

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105616136-105685211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105658329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 637 (D637V)

Ref Sequence

ENSEMBL: ENSMUSP00000037441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041055]

AlphaFold

Q80XK6

Predicted Effect

probably benign
Transcript: ENSMUST00000041055
AA Change: D637V

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: D637V

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	11	127	3.5e-19	PFAM
low complexity region	286	298	N/A	INTRINSIC
low complexity region	409	428	N/A	INTRINSIC
low complexity region	864	870	N/A	INTRINSIC
low complexity region	893	904	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
Pfam:ATG_C	1976	2071	1.4e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221568

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Usp25	T	A	16: 77,093,706	D767E	probably benign	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Atg2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Atg2b	APN	12	105644916	missense	probably benign	0.20
IGL01326:Atg2b	APN	12	105622144	missense	probably damaging	1.00
IGL02063:Atg2b	APN	12	105648322	missense	possibly damaging	0.89
IGL02260:Atg2b	APN	12	105636440	splice site	probably benign
IGL02376:Atg2b	APN	12	105645468	missense	probably damaging	1.00
IGL02381:Atg2b	APN	12	105648348	missense	probably damaging	1.00
IGL02434:Atg2b	APN	12	105639207	missense	probably benign	0.00
IGL02534:Atg2b	APN	12	105643267	missense	probably damaging	1.00
IGL03011:Atg2b	APN	12	105626362	missense	probably damaging	0.98
IGL03173:Atg2b	APN	12	105658294	missense	possibly damaging	0.68
R6669_atg2b_067	UTSW	12	105671529	missense	possibly damaging	0.90
rail	UTSW	12	105658840	nonsense	probably null
Sora	UTSW	12	105623430	missense	probably benign	0.06
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0511:Atg2b	UTSW	12	105617153	missense	probably damaging	1.00
R0762:Atg2b	UTSW	12	105674970	missense	possibly damaging	0.56
R0786:Atg2b	UTSW	12	105636508	missense	probably benign	0.00
R1029:Atg2b	UTSW	12	105635773	missense	probably damaging	0.96
R1529:Atg2b	UTSW	12	105661133	missense	probably benign
R1563:Atg2b	UTSW	12	105623488	missense	probably damaging	0.99
R1746:Atg2b	UTSW	12	105669329	missense	possibly damaging	0.79
R1887:Atg2b	UTSW	12	105654092	missense	probably benign	0.01
R1956:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R1957:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R2272:Atg2b	UTSW	12	105638008	missense	probably benign	0.00
R2877:Atg2b	UTSW	12	105664009	nonsense	probably null
R2878:Atg2b	UTSW	12	105664009	nonsense	probably null
R4798:Atg2b	UTSW	12	105652629	missense	probably benign	0.37
R4836:Atg2b	UTSW	12	105646814	missense	probably benign
R5007:Atg2b	UTSW	12	105643876	splice site	probably null
R5042:Atg2b	UTSW	12	105621262	missense	probably benign	0.01
R5134:Atg2b	UTSW	12	105674950	missense	probably damaging	0.96
R5212:Atg2b	UTSW	12	105646796	missense	probably benign	0.00
R5250:Atg2b	UTSW	12	105635765	missense	probably damaging	1.00
R5342:Atg2b	UTSW	12	105658916	missense	possibly damaging	0.90
R5583:Atg2b	UTSW	12	105649155	missense	possibly damaging	0.94
R5656:Atg2b	UTSW	12	105621328	missense	probably benign	0.00
R5660:Atg2b	UTSW	12	105649124	nonsense	probably null
R5903:Atg2b	UTSW	12	105639359	missense	possibly damaging	0.90
R6018:Atg2b	UTSW	12	105661171	missense	probably damaging	0.96
R6153:Atg2b	UTSW	12	105623482	missense	possibly damaging	0.80
R6326:Atg2b	UTSW	12	105661092	nonsense	probably null
R6584:Atg2b	UTSW	12	105657995	missense	probably damaging	1.00
R6593:Atg2b	UTSW	12	105644848	missense	probably damaging	1.00
R6669:Atg2b	UTSW	12	105671529	missense	possibly damaging	0.90
R6847:Atg2b	UTSW	12	105635788	missense	probably damaging	1.00
R7003:Atg2b	UTSW	12	105654249	missense	probably benign	0.01
R7193:Atg2b	UTSW	12	105664708	missense	probably damaging	1.00
R7387:Atg2b	UTSW	12	105622775	missense	probably damaging	1.00
R7432:Atg2b	UTSW	12	105661204	missense	probably damaging	0.98
R7432:Atg2b	UTSW	12	105664698	missense	probably benign	0.08
R7630:Atg2b	UTSW	12	105646954	critical splice acceptor site	probably null
R7634:Atg2b	UTSW	12	105652120	missense	probably damaging	1.00
R7645:Atg2b	UTSW	12	105623430	missense	probably benign	0.06
R7653:Atg2b	UTSW	12	105636472	missense	possibly damaging	0.68
R8157:Atg2b	UTSW	12	105662940	missense	probably damaging	1.00
R8222:Atg2b	UTSW	12	105652216	missense	possibly damaging	0.95
R8469:Atg2b	UTSW	12	105637911	missense	probably benign	0.00
R8708:Atg2b	UTSW	12	105669428	critical splice acceptor site	probably benign
R8784:Atg2b	UTSW	12	105639241	missense	probably damaging	1.00
R8975:Atg2b	UTSW	12	105636466	missense	probably damaging	1.00
R8988:Atg2b	UTSW	12	105617129	missense	probably damaging	0.97
R9071:Atg2b	UTSW	12	105658840	nonsense	probably null
R9269:Atg2b	UTSW	12	105652100	missense	probably damaging	1.00
R9355:Atg2b	UTSW	12	105670721	missense	possibly damaging	0.48
R9402:Atg2b	UTSW	12	105648423	missense	probably damaging	0.98
R9492:Atg2b	UTSW	12	105658290	missense	probably benign	0.06
R9709:Atg2b	UTSW	12	105644881	missense	probably damaging	1.00
R9717:Atg2b	UTSW	12	105639302	missense	probably benign
R9746:Atg2b	UTSW	12	105663938	missense	possibly damaging	0.84
X0018:Atg2b	UTSW	12	105666697	missense	possibly damaging	0.86
X0066:Atg2b	UTSW	12	105646785	missense	probably benign	0.12
Z1177:Atg2b	UTSW	12	105635764	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAACTAAGTCTTGCTTGATTACCC -3'
(R):5'- ATGAGGCGCTGAGTTTCACAG -3'

Sequencing Primer
(F):5'- TGGTAAAACTAGGTTAAAAACTG -3'
(R):5'- GAGTTTCACAGCACTTGGC -3'

Posted On

2016-07-22