Mutagenetix > Incidental Mutation

Incidental Mutation 'R5307:Usp25'

404676

Institutional Source

Beutler Lab

Gene Symbol

Usp25

Ensembl Gene

ENSMUSG00000022867

Gene Name

ubiquitin specific peptidase 25

Synonyms

MMRRC Submission

042890-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5307 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77013706-77116780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77093706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 767 (D767E)

Ref Sequence

ENSEMBL: ENSMUSP00000023580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023580]

AlphaFold

P57080

PDB Structure

Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000023580
AA Change: D767E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: D767E

Domain	Start	End	E-Value	Type
PDB:1VDL\|A	1	67	2e-35	PDB
Blast:UBA	17	56	9e-16	BLAST
UIM	97	116	5.27e-3	SMART
Pfam:UIM	124	140	6.7e-3	PFAM
Pfam:UCH	168	655	9.3e-55	PFAM
Pfam:UCH_1	169	632	3.1e-14	PFAM
coiled coil region	685	714	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232538

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	G	3: 124,406,350	G531A	probably damaging	Het
2410089E03Rik	G	A	15: 8,260,690		probably null	Het
Abca8b	C	A	11: 109,977,813	G175V	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Ap3d1	T	C	10: 80,723,549	T264A	probably benign	Het
Arhgef17	C	G	7: 100,929,428	G771A	probably benign	Het
Atg2b	T	A	12: 105,658,329	D637V	probably benign	Het
Atp10b	A	G	11: 43,212,475	E562G	probably damaging	Het
Atp1a1	A	G	3: 101,589,964	V342A	probably damaging	Het
Atp2a2	A	G	5: 122,461,747	I527T	probably benign	Het
Atr	T	A	9: 95,878,544	N1022K	probably benign	Het
Bach2	T	A	4: 32,562,683	D383E	probably benign	Het
Casq1	A	T	1: 172,219,416	L92Q	probably damaging	Het
Chd1	T	A	17: 15,732,570	Y371N	probably damaging	Het
Chd9	G	A	8: 90,997,149	A617T	probably damaging	Het
Cntrob	T	A	11: 69,314,750	R419S	possibly damaging	Het
Corin	C	A	5: 72,356,978	G318C	probably damaging	Het
Cpa3	A	G	3: 20,227,163		probably null	Het
Crybg1	T	C	10: 44,003,714	S493G	probably benign	Het
Ddc	A	G	11: 11,876,321	F80S	probably damaging	Het
Dhrs2	A	G	14: 55,236,144	S87G	possibly damaging	Het
Dnah12	A	G	14: 26,693,486	E14G	possibly damaging	Het
Dtd1	A	G	2: 144,747,022	E200G	possibly damaging	Het
Dync2h1	T	C	9: 7,155,099	E895G	probably damaging	Het
Ehhadh	A	C	16: 21,762,692	S517A	probably benign	Het
Ephb2	C	A	4: 136,693,787	Q417H	possibly damaging	Het
Ephb4	A	G	5: 137,363,312	T526A	probably damaging	Het
Fam222b	G	A	11: 78,153,768	V52I	probably damaging	Het
Galm	G	A	17: 80,144,987	W118*	probably null	Het
Galm	G	T	17: 80,144,988	W118C	probably damaging	Het
Gcfc2	A	G	6: 81,944,386	N458D	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gykl1	A	C	18: 52,694,651	R310S	possibly damaging	Het
Gzmn	A	C	14: 56,167,946	V27G	probably damaging	Het
H2-T23	T	A	17: 36,032,216	M90L	probably benign	Het
Hnrnpu	T	C	1: 178,337,312	E87G	unknown	Het
Hps3	G	A	3: 20,012,701	S567L	possibly damaging	Het
Igfn1	A	T	1: 135,964,938	V2148E	probably damaging	Het
Ighv1-75	T	C	12: 115,833,952	R117G	probably damaging	Het
Itgae	C	T	11: 73,145,638	A1134V	probably benign	Het
Kmt2b	C	T	7: 30,581,673	A1294T	possibly damaging	Het
Leng8	C	T	7: 4,145,473	T748I	probably damaging	Het
Lrig3	G	C	10: 126,006,690	D495H	probably damaging	Het
Mctp1	G	A	13: 76,712,079		probably null	Het
Mfsd3	T	A	15: 76,702,171	L168*	probably null	Het
Nlrp4d	C	A	7: 10,362,782	G921*	probably null	Het
Nsun4	G	A	4: 116,034,138	T348I	probably damaging	Het
Nucb1	T	C	7: 45,498,418	T246A	probably damaging	Het
Nynrin	A	C	14: 55,863,806	S311R	probably damaging	Het
Olfr1019	T	G	2: 85,841,014	Y259S	probably damaging	Het
Olfr1281	T	A	2: 111,328,396		probably null	Het
Ovch2	C	A	7: 107,792,134	R303L	probably benign	Het
Pcsk9	A	G	4: 106,447,174	S490P	probably damaging	Het
Pi4ka	A	G	16: 17,323,030	F859L	probably benign	Het
Pkd1l3	A	G	8: 109,640,792	D1207G	probably damaging	Het
Pnpla7	G	A	2: 25,021,952	R710Q	possibly damaging	Het
Prex2	T	G	1: 11,200,032	S1314A	probably damaging	Het
Rnf216	A	G	5: 143,093,002	L64P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc6a20b	T	G	9: 123,603,834	S374R	possibly damaging	Het
Slc8a1	G	T	17: 81,649,224	N128K	probably damaging	Het
Slc9a3r1	T	A	11: 115,163,761	I79N	probably damaging	Het
Slfn5	A	T	11: 82,956,385	D32V	probably damaging	Het
Snrnp35	T	C	5: 124,490,490	I122T	possibly damaging	Het
Snx24	C	T	18: 53,340,211	Q76*	probably null	Het
Sspo	T	A	6: 48,454,850	H692Q	probably damaging	Het
Stxbp3	T	C	3: 108,793,798	D585G	probably damaging	Het
Svep1	T	C	4: 58,072,677	N2211D	possibly damaging	Het
Tnfrsf18	G	A	4: 156,028,424		probably null	Het
Tnik	T	G	3: 28,541,972	D171E	probably damaging	Het
Ttc23l	T	A	15: 10,533,659	H266L	probably damaging	Het
Ttn	G	T	2: 76,894,770	S2037*	probably null	Het
Tuba3a	G	A	6: 125,281,310	T239I	probably damaging	Het
Whrn	G	T	4: 63,431,843	H546N	probably benign	Het
Xirp2	C	T	2: 67,511,162	T1249I	probably damaging	Het
Zbtb1	T	A	12: 76,386,240	D333E	probably damaging	Het
Zfp689	T	G	7: 127,448,815	E15A	possibly damaging	Het
Zhx3	A	G	2: 160,779,868	M793T	probably benign	Het

Other mutations in Usp25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Usp25	APN	16	77062405	missense	probably damaging	1.00
IGL01359:Usp25	APN	16	77059253	missense	probably damaging	1.00
IGL01380:Usp25	APN	16	77093678	missense	probably benign	0.06
IGL01614:Usp25	APN	16	77077117	missense	probably damaging	1.00
IGL02065:Usp25	APN	16	77083782	missense	probably benign	0.06
IGL02271:Usp25	APN	16	77115447	missense	probably damaging	1.00
IGL03184:Usp25	APN	16	77081653	missense	probably damaging	1.00
IGL03046:Usp25	UTSW	16	77074866	missense	probably damaging	1.00
R0433:Usp25	UTSW	16	77109217	missense	probably benign	0.02
R0741:Usp25	UTSW	16	77071708	missense	possibly damaging	0.80
R0944:Usp25	UTSW	16	77081447	splice site	probably benign
R1324:Usp25	UTSW	16	77080387	missense	probably damaging	0.98
R1341:Usp25	UTSW	16	77115443	missense	probably benign
R1373:Usp25	UTSW	16	77062385	splice site	probably benign
R1641:Usp25	UTSW	16	77071671	missense	possibly damaging	0.89
R1777:Usp25	UTSW	16	77081554	missense	probably damaging	1.00
R1813:Usp25	UTSW	16	77114950	missense	probably benign	0.00
R1960:Usp25	UTSW	16	77076371	missense	probably damaging	1.00
R2256:Usp25	UTSW	16	77113794	missense	probably benign
R2271:Usp25	UTSW	16	77076429	missense	probably damaging	0.97
R4404:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4408:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4502:Usp25	UTSW	16	77115396	missense	probably damaging	1.00
R4604:Usp25	UTSW	16	77115415	missense	probably damaging	1.00
R4612:Usp25	UTSW	16	77033945	missense	possibly damaging	0.92
R4744:Usp25	UTSW	16	77114989	missense	probably damaging	1.00
R4867:Usp25	UTSW	16	77050467	missense	probably damaging	1.00
R4932:Usp25	UTSW	16	77033982	critical splice donor site	probably null
R5087:Usp25	UTSW	16	77077119	missense	probably benign	0.00
R5165:Usp25	UTSW	16	77076405	missense	possibly damaging	0.85
R5184:Usp25	UTSW	16	77109227	missense	probably benign	0.00
R5331:Usp25	UTSW	16	77050558	missense	probably damaging	1.00
R5355:Usp25	UTSW	16	77050454	missense	probably damaging	1.00
R5479:Usp25	UTSW	16	77107913	missense	possibly damaging	0.51
R5619:Usp25	UTSW	16	77033945	missense	probably benign	0.22
R5646:Usp25	UTSW	16	77050472	missense	probably benign	0.34
R5946:Usp25	UTSW	16	77115054	nonsense	probably null
R6013:Usp25	UTSW	16	77077021	missense	probably benign	0.00
R6418:Usp25	UTSW	16	77062442	missense	probably damaging	1.00
R6653:Usp25	UTSW	16	77059288	missense	probably benign	0.29
R6709:Usp25	UTSW	16	77083932	missense	probably benign
R6987:Usp25	UTSW	16	77077180	missense	probably damaging	1.00
R7418:Usp25	UTSW	16	77113842	nonsense	probably null
R7500:Usp25	UTSW	16	77077201	missense	probably damaging	1.00
R7886:Usp25	UTSW	16	77113771	missense	probably damaging	0.99
R7961:Usp25	UTSW	16	77059262	missense	probably damaging	1.00
R8005:Usp25	UTSW	16	77077068	missense	probably benign
R8046:Usp25	UTSW	16	77109175	missense	probably damaging	1.00
R8069:Usp25	UTSW	16	77069055	missense	possibly damaging	0.58
R8140:Usp25	UTSW	16	77071681	nonsense	probably null
R8167:Usp25	UTSW	16	77107931	missense	probably damaging	1.00
R8437:Usp25	UTSW	16	77033912	missense	probably damaging	1.00
R8704:Usp25	UTSW	16	77059290	missense	probably benign	0.00
R8903:Usp25	UTSW	16	77081533	missense	probably damaging	1.00
R9123:Usp25	UTSW	16	77115081	critical splice donor site	probably null
R9276:Usp25	UTSW	16	77113833	missense	probably benign	0.09
R9286:Usp25	UTSW	16	77107976	missense	probably damaging	1.00
R9368:Usp25	UTSW	16	77107955	missense	probably damaging	1.00
R9489:Usp25	UTSW	16	77077158	missense	probably damaging	1.00
R9515:Usp25	UTSW	16	77055188	missense	probably damaging	1.00
R9516:Usp25	UTSW	16	77055188	missense	probably damaging	1.00
R9580:Usp25	UTSW	16	77083794	missense	probably benign	0.00
R9605:Usp25	UTSW	16	77077158	missense	probably damaging	1.00
R9667:Usp25	UTSW	16	77077235	critical splice donor site	probably null
X0065:Usp25	UTSW	16	77081556	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77071791	missense	probably damaging	0.98
Z1176:Usp25	UTSW	16	77071792	missense	possibly damaging	0.93
Z1176:Usp25	UTSW	16	77081521	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77083913	missense	probably benign
Z1176:Usp25	UTSW	16	77113830	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCACCGAACTTAGCTTGGTTC -3'
(R):5'- TCACACACTGAGGAAATGACAG -3'

Sequencing Primer
(F):5'- GAATTAGACATAAGCTCCCGGTTTC -3'
(R):5'- CTGAGGAAATGACAGCCCGC -3'

Posted On

2016-07-22