Incidental Mutation 'R5307:Usp25'
ID 404676
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Name ubiquitin specific peptidase 25
Synonyms
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 76810594-76913668 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76890594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 767 (D767E)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
AlphaFold P57080
PDB Structure Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000023580
AA Change: D767E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: D767E

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232538
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,199,999 (GRCm39) G531A probably damaging Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Ap3d1 T C 10: 80,559,383 (GRCm39) T264A probably benign Het
Arhgef17 C G 7: 100,578,635 (GRCm39) G771A probably benign Het
Atg2b T A 12: 105,624,588 (GRCm39) D637V probably benign Het
Atp10b A G 11: 43,103,302 (GRCm39) E562G probably damaging Het
Atp1a1 A G 3: 101,497,280 (GRCm39) V342A probably damaging Het
Atp2a2 A G 5: 122,599,810 (GRCm39) I527T probably benign Het
Atr T A 9: 95,760,597 (GRCm39) N1022K probably benign Het
Bach2 T A 4: 32,562,683 (GRCm39) D383E probably benign Het
Casq1 A T 1: 172,046,983 (GRCm39) L92Q probably damaging Het
Chd1 T A 17: 15,952,832 (GRCm39) Y371N probably damaging Het
Chd9 G A 8: 91,723,777 (GRCm39) A617T probably damaging Het
Cntrob T A 11: 69,205,576 (GRCm39) R419S possibly damaging Het
Corin C A 5: 72,514,321 (GRCm39) G318C probably damaging Het
Cpa3 A G 3: 20,281,327 (GRCm39) probably null Het
Cplane1 G A 15: 8,290,174 (GRCm39) probably null Het
Crybg1 T C 10: 43,879,710 (GRCm39) S493G probably benign Het
Ddc A G 11: 11,826,321 (GRCm39) F80S probably damaging Het
Dhrs2 A G 14: 55,473,601 (GRCm39) S87G possibly damaging Het
Dnah12 A G 14: 26,414,641 (GRCm39) E14G possibly damaging Het
Dtd1 A G 2: 144,588,942 (GRCm39) E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 (GRCm39) E895G probably damaging Het
Ehhadh A C 16: 21,581,442 (GRCm39) S517A probably benign Het
Ephb2 C A 4: 136,421,098 (GRCm39) Q417H possibly damaging Het
Ephb4 A G 5: 137,361,574 (GRCm39) T526A probably damaging Het
Fam222b G A 11: 78,044,594 (GRCm39) V52I probably damaging Het
Galm G A 17: 80,452,416 (GRCm39) W118* probably null Het
Galm G T 17: 80,452,417 (GRCm39) W118C probably damaging Het
Gcfc2 A G 6: 81,921,367 (GRCm39) N458D probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Gykl1 A C 18: 52,827,723 (GRCm39) R310S possibly damaging Het
Gzmn A C 14: 56,405,403 (GRCm39) V27G probably damaging Het
H2-T23 T A 17: 36,343,108 (GRCm39) M90L probably benign Het
Hnrnpu T C 1: 178,164,877 (GRCm39) E87G unknown Het
Hps3 G A 3: 20,066,865 (GRCm39) S567L possibly damaging Het
Igfn1 A T 1: 135,892,676 (GRCm39) V2148E probably damaging Het
Ighv1-75 T C 12: 115,797,572 (GRCm39) R117G probably damaging Het
Itgae C T 11: 73,036,464 (GRCm39) A1134V probably benign Het
Kmt2b C T 7: 30,281,098 (GRCm39) A1294T possibly damaging Het
Leng8 C T 7: 4,148,472 (GRCm39) T748I probably damaging Het
Lrig3 G C 10: 125,842,559 (GRCm39) D495H probably damaging Het
Mctp1 G A 13: 76,860,198 (GRCm39) probably null Het
Mfsd3 T A 15: 76,586,371 (GRCm39) L168* probably null Het
Nherf1 T A 11: 115,054,587 (GRCm39) I79N probably damaging Het
Nlrp4d C A 7: 10,096,709 (GRCm39) G921* probably null Het
Nsun4 G A 4: 115,891,335 (GRCm39) T348I probably damaging Het
Nucb1 T C 7: 45,147,842 (GRCm39) T246A probably damaging Het
Nynrin A C 14: 56,101,263 (GRCm39) S311R probably damaging Het
Or4k37 T A 2: 111,158,741 (GRCm39) probably null Het
Or5ar1 T G 2: 85,671,358 (GRCm39) Y259S probably damaging Het
Ovch2 C A 7: 107,391,341 (GRCm39) R303L probably benign Het
Pcsk9 A G 4: 106,304,371 (GRCm39) S490P probably damaging Het
Pi4ka A G 16: 17,140,894 (GRCm39) F859L probably benign Het
Pkd1l3 A G 8: 110,367,424 (GRCm39) D1207G probably damaging Het
Pnpla7 G A 2: 24,911,964 (GRCm39) R710Q possibly damaging Het
Prex2 T G 1: 11,270,256 (GRCm39) S1314A probably damaging Het
Rnf216 A G 5: 143,078,757 (GRCm39) L64P probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc6a20b T G 9: 123,432,899 (GRCm39) S374R possibly damaging Het
Slc8a1 G T 17: 81,956,653 (GRCm39) N128K probably damaging Het
Slfn5 A T 11: 82,847,211 (GRCm39) D32V probably damaging Het
Snrnp35 T C 5: 124,628,553 (GRCm39) I122T possibly damaging Het
Snx24 C T 18: 53,473,283 (GRCm39) Q76* probably null Het
Sspo T A 6: 48,431,784 (GRCm39) H692Q probably damaging Het
Stxbp3 T C 3: 108,701,114 (GRCm39) D585G probably damaging Het
Svep1 T C 4: 58,072,677 (GRCm39) N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,112,881 (GRCm39) probably null Het
Tnik T G 3: 28,596,121 (GRCm39) D171E probably damaging Het
Ttc23l T A 15: 10,533,745 (GRCm39) H266L probably damaging Het
Ttn G T 2: 76,725,114 (GRCm39) S2037* probably null Het
Tuba3a G A 6: 125,258,273 (GRCm39) T239I probably damaging Het
Whrn G T 4: 63,350,080 (GRCm39) H546N probably benign Het
Xirp2 C T 2: 67,341,506 (GRCm39) T1249I probably damaging Het
Zbtb1 T A 12: 76,433,014 (GRCm39) D333E probably damaging Het
Zfp689 T G 7: 127,047,987 (GRCm39) E15A possibly damaging Het
Zhx3 A G 2: 160,621,788 (GRCm39) M793T probably benign Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 76,859,293 (GRCm39) missense probably damaging 1.00
IGL01359:Usp25 APN 16 76,856,141 (GRCm39) missense probably damaging 1.00
IGL01380:Usp25 APN 16 76,890,566 (GRCm39) missense probably benign 0.06
IGL01614:Usp25 APN 16 76,874,005 (GRCm39) missense probably damaging 1.00
IGL02065:Usp25 APN 16 76,880,670 (GRCm39) missense probably benign 0.06
IGL02271:Usp25 APN 16 76,912,335 (GRCm39) missense probably damaging 1.00
IGL03184:Usp25 APN 16 76,878,541 (GRCm39) missense probably damaging 1.00
IGL03046:Usp25 UTSW 16 76,871,754 (GRCm39) missense probably damaging 1.00
R0433:Usp25 UTSW 16 76,906,105 (GRCm39) missense probably benign 0.02
R0741:Usp25 UTSW 16 76,868,596 (GRCm39) missense possibly damaging 0.80
R0944:Usp25 UTSW 16 76,878,335 (GRCm39) splice site probably benign
R1324:Usp25 UTSW 16 76,877,275 (GRCm39) missense probably damaging 0.98
R1341:Usp25 UTSW 16 76,912,331 (GRCm39) missense probably benign
R1373:Usp25 UTSW 16 76,859,273 (GRCm39) splice site probably benign
R1641:Usp25 UTSW 16 76,868,559 (GRCm39) missense possibly damaging 0.89
R1777:Usp25 UTSW 16 76,878,442 (GRCm39) missense probably damaging 1.00
R1813:Usp25 UTSW 16 76,911,838 (GRCm39) missense probably benign 0.00
R1960:Usp25 UTSW 16 76,873,259 (GRCm39) missense probably damaging 1.00
R2256:Usp25 UTSW 16 76,910,682 (GRCm39) missense probably benign
R2271:Usp25 UTSW 16 76,873,317 (GRCm39) missense probably damaging 0.97
R4404:Usp25 UTSW 16 76,912,341 (GRCm39) missense probably damaging 1.00
R4408:Usp25 UTSW 16 76,912,341 (GRCm39) missense probably damaging 1.00
R4502:Usp25 UTSW 16 76,912,284 (GRCm39) missense probably damaging 1.00
R4604:Usp25 UTSW 16 76,912,303 (GRCm39) missense probably damaging 1.00
R4612:Usp25 UTSW 16 76,830,833 (GRCm39) missense possibly damaging 0.92
R4744:Usp25 UTSW 16 76,911,877 (GRCm39) missense probably damaging 1.00
R4867:Usp25 UTSW 16 76,847,355 (GRCm39) missense probably damaging 1.00
R4932:Usp25 UTSW 16 76,830,870 (GRCm39) critical splice donor site probably null
R5087:Usp25 UTSW 16 76,874,007 (GRCm39) missense probably benign 0.00
R5165:Usp25 UTSW 16 76,873,293 (GRCm39) missense possibly damaging 0.85
R5184:Usp25 UTSW 16 76,906,115 (GRCm39) missense probably benign 0.00
R5331:Usp25 UTSW 16 76,847,446 (GRCm39) missense probably damaging 1.00
R5355:Usp25 UTSW 16 76,847,342 (GRCm39) missense probably damaging 1.00
R5479:Usp25 UTSW 16 76,904,801 (GRCm39) missense possibly damaging 0.51
R5619:Usp25 UTSW 16 76,830,833 (GRCm39) missense probably benign 0.22
R5646:Usp25 UTSW 16 76,847,360 (GRCm39) missense probably benign 0.34
R5946:Usp25 UTSW 16 76,911,942 (GRCm39) nonsense probably null
R6013:Usp25 UTSW 16 76,873,909 (GRCm39) missense probably benign 0.00
R6418:Usp25 UTSW 16 76,859,330 (GRCm39) missense probably damaging 1.00
R6653:Usp25 UTSW 16 76,856,176 (GRCm39) missense probably benign 0.29
R6709:Usp25 UTSW 16 76,880,820 (GRCm39) missense probably benign
R6987:Usp25 UTSW 16 76,874,068 (GRCm39) missense probably damaging 1.00
R7418:Usp25 UTSW 16 76,910,730 (GRCm39) nonsense probably null
R7500:Usp25 UTSW 16 76,874,089 (GRCm39) missense probably damaging 1.00
R7886:Usp25 UTSW 16 76,910,659 (GRCm39) missense probably damaging 0.99
R7961:Usp25 UTSW 16 76,856,150 (GRCm39) missense probably damaging 1.00
R8005:Usp25 UTSW 16 76,873,956 (GRCm39) missense probably benign
R8046:Usp25 UTSW 16 76,906,063 (GRCm39) missense probably damaging 1.00
R8069:Usp25 UTSW 16 76,865,943 (GRCm39) missense possibly damaging 0.58
R8140:Usp25 UTSW 16 76,868,569 (GRCm39) nonsense probably null
R8167:Usp25 UTSW 16 76,904,819 (GRCm39) missense probably damaging 1.00
R8437:Usp25 UTSW 16 76,830,800 (GRCm39) missense probably damaging 1.00
R8704:Usp25 UTSW 16 76,856,178 (GRCm39) missense probably benign 0.00
R8903:Usp25 UTSW 16 76,878,421 (GRCm39) missense probably damaging 1.00
R9123:Usp25 UTSW 16 76,911,969 (GRCm39) critical splice donor site probably null
R9276:Usp25 UTSW 16 76,910,721 (GRCm39) missense probably benign 0.09
R9286:Usp25 UTSW 16 76,904,864 (GRCm39) missense probably damaging 1.00
R9368:Usp25 UTSW 16 76,904,843 (GRCm39) missense probably damaging 1.00
R9489:Usp25 UTSW 16 76,874,046 (GRCm39) missense probably damaging 1.00
R9515:Usp25 UTSW 16 76,852,076 (GRCm39) missense probably damaging 1.00
R9516:Usp25 UTSW 16 76,852,076 (GRCm39) missense probably damaging 1.00
R9580:Usp25 UTSW 16 76,880,682 (GRCm39) missense probably benign 0.00
R9605:Usp25 UTSW 16 76,874,046 (GRCm39) missense probably damaging 1.00
R9667:Usp25 UTSW 16 76,874,123 (GRCm39) critical splice donor site probably null
X0065:Usp25 UTSW 16 76,878,444 (GRCm39) missense probably damaging 1.00
Z1176:Usp25 UTSW 16 76,878,409 (GRCm39) missense probably damaging 1.00
Z1176:Usp25 UTSW 16 76,868,680 (GRCm39) missense possibly damaging 0.93
Z1176:Usp25 UTSW 16 76,868,679 (GRCm39) missense probably damaging 0.98
Z1176:Usp25 UTSW 16 76,910,718 (GRCm39) missense probably benign
Z1176:Usp25 UTSW 16 76,880,801 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACCGAACTTAGCTTGGTTC -3'
(R):5'- TCACACACTGAGGAAATGACAG -3'

Sequencing Primer
(F):5'- GAATTAGACATAAGCTCCCGGTTTC -3'
(R):5'- CTGAGGAAATGACAGCCCGC -3'
Posted On 2016-07-22