Incidental Mutation 'R5307:Galm'
ID 404682
Institutional Source Beutler Lab
Gene Symbol Galm
Ensembl Gene ENSMUSG00000035473
Gene Name galactose mutarotase
Synonyms A530057M15Rik, aldose 1-epimerase
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 80127471-80185101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80144988 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Cysteine at position 118 (W118C)
Ref Sequence ENSEMBL: ENSMUSP00000040580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039205]
AlphaFold Q8K157
Predicted Effect probably damaging
Transcript: ENSMUST00000039205
AA Change: W118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040580
Gene: ENSMUSG00000035473
AA Change: W118C

DomainStartEndE-ValueType
Pfam:Aldose_epim 20 338 7.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133955
SMART Domains Protein: ENSMUSP00000120018
Gene: ENSMUSG00000035473

DomainStartEndE-ValueType
Pfam:Aldose_epim 1 159 6.1e-41 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the epimerization of hexose sugars such as glucose and galactose. The encoded protein is expressed in the cytoplasm and has a preference for galactose. The encoded protein may be required for normal galactose metabolism by maintaining the equilibrium of alpha and beta anomers of galactose.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc8a1 G T 17: 81,649,224 N128K probably damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Galm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Galm APN 17 80183280 missense probably benign 0.03
IGL02057:Galm APN 17 80181567 missense probably benign 0.05
IGL02212:Galm APN 17 80150117 missense probably benign 0.09
IGL02239:Galm APN 17 80145038 missense probably damaging 1.00
R1442:Galm UTSW 17 80145185 missense probably damaging 0.99
R1511:Galm UTSW 17 80183267 missense probably damaging 1.00
R2129:Galm UTSW 17 80183218 missense probably benign
R2298:Galm UTSW 17 80181697 nonsense probably null
R3724:Galm UTSW 17 80183280 missense probably benign 0.03
R5307:Galm UTSW 17 80144987 nonsense probably null
R5602:Galm UTSW 17 80150139 nonsense probably null
R5778:Galm UTSW 17 80127717 start codon destroyed probably null 1.00
R5873:Galm UTSW 17 80138103 missense probably benign 0.19
R6801:Galm UTSW 17 80181624 missense probably benign 0.01
R7454:Galm UTSW 17 80138121 missense possibly damaging 0.76
R8304:Galm UTSW 17 80183337 missense probably damaging 0.98
R8812:Galm UTSW 17 80127786 missense probably damaging 1.00
R8856:Galm UTSW 17 80183232 missense possibly damaging 0.95
R9474:Galm UTSW 17 80150132 missense possibly damaging 0.76
R9562:Galm UTSW 17 80183430 nonsense probably null
Z1176:Galm UTSW 17 80183233 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GAGGAAAGTGTTTTCTCTCAAAAGC -3'
(R):5'- GGCCTGCTAGGTTGAAATAAGAATG -3'

Sequencing Primer
(F):5'- GCCTTCTCTTTGTGTATGAAACAG -3'
(R):5'- TAAGAATGGTTGGTCAGATTAACTGG -3'
Posted On 2016-07-22