Incidental Mutation 'R5307:Slc8a1'
ID 404683
Institutional Source Beutler Lab
Gene Symbol Slc8a1
Ensembl Gene ENSMUSG00000054640
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms Ncx1, D930008O12Rik
MMRRC Submission 042890-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5307 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 81388691-81649607 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 81649224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 128 (N128K)
Ref Sequence ENSEMBL: ENSMUSP00000126373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000086538
AA Change: N128K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: N128K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163123
AA Change: N128K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: N128K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 87 246 4.6e-38 PFAM
coiled coil region 313 332 N/A INTRINSIC
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 742 753 N/A INTRINSIC
Pfam:Na_Ca_ex 794 947 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163680
AA Change: N128K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: N128K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ap3d1 T C 10: 80,723,549 T264A probably benign Het
Arhgef17 C G 7: 100,929,428 G771A probably benign Het
Atg2b T A 12: 105,658,329 D637V probably benign Het
Atp10b A G 11: 43,212,475 E562G probably damaging Het
Atp1a1 A G 3: 101,589,964 V342A probably damaging Het
Atp2a2 A G 5: 122,461,747 I527T probably benign Het
Atr T A 9: 95,878,544 N1022K probably benign Het
Bach2 T A 4: 32,562,683 D383E probably benign Het
Casq1 A T 1: 172,219,416 L92Q probably damaging Het
Chd1 T A 17: 15,732,570 Y371N probably damaging Het
Chd9 G A 8: 90,997,149 A617T probably damaging Het
Cntrob T A 11: 69,314,750 R419S possibly damaging Het
Corin C A 5: 72,356,978 G318C probably damaging Het
Cpa3 A G 3: 20,227,163 probably null Het
Crybg1 T C 10: 44,003,714 S493G probably benign Het
Ddc A G 11: 11,876,321 F80S probably damaging Het
Dhrs2 A G 14: 55,236,144 S87G possibly damaging Het
Dnah12 A G 14: 26,693,486 E14G possibly damaging Het
Dtd1 A G 2: 144,747,022 E200G possibly damaging Het
Dync2h1 T C 9: 7,155,099 E895G probably damaging Het
Ehhadh A C 16: 21,762,692 S517A probably benign Het
Ephb2 C A 4: 136,693,787 Q417H possibly damaging Het
Ephb4 A G 5: 137,363,312 T526A probably damaging Het
Fam222b G A 11: 78,153,768 V52I probably damaging Het
Galm G A 17: 80,144,987 W118* probably null Het
Galm G T 17: 80,144,988 W118C probably damaging Het
Gcfc2 A G 6: 81,944,386 N458D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gykl1 A C 18: 52,694,651 R310S possibly damaging Het
Gzmn A C 14: 56,167,946 V27G probably damaging Het
H2-T23 T A 17: 36,032,216 M90L probably benign Het
Hnrnpu T C 1: 178,337,312 E87G unknown Het
Hps3 G A 3: 20,012,701 S567L possibly damaging Het
Igfn1 A T 1: 135,964,938 V2148E probably damaging Het
Ighv1-75 T C 12: 115,833,952 R117G probably damaging Het
Itgae C T 11: 73,145,638 A1134V probably benign Het
Kmt2b C T 7: 30,581,673 A1294T possibly damaging Het
Leng8 C T 7: 4,145,473 T748I probably damaging Het
Lrig3 G C 10: 126,006,690 D495H probably damaging Het
Mctp1 G A 13: 76,712,079 probably null Het
Mfsd3 T A 15: 76,702,171 L168* probably null Het
Nlrp4d C A 7: 10,362,782 G921* probably null Het
Nsun4 G A 4: 116,034,138 T348I probably damaging Het
Nucb1 T C 7: 45,498,418 T246A probably damaging Het
Nynrin A C 14: 55,863,806 S311R probably damaging Het
Olfr1019 T G 2: 85,841,014 Y259S probably damaging Het
Olfr1281 T A 2: 111,328,396 probably null Het
Ovch2 C A 7: 107,792,134 R303L probably benign Het
Pcsk9 A G 4: 106,447,174 S490P probably damaging Het
Pi4ka A G 16: 17,323,030 F859L probably benign Het
Pkd1l3 A G 8: 109,640,792 D1207G probably damaging Het
Pnpla7 G A 2: 25,021,952 R710Q possibly damaging Het
Prex2 T G 1: 11,200,032 S1314A probably damaging Het
Rnf216 A G 5: 143,093,002 L64P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc6a20b T G 9: 123,603,834 S374R possibly damaging Het
Slc9a3r1 T A 11: 115,163,761 I79N probably damaging Het
Slfn5 A T 11: 82,956,385 D32V probably damaging Het
Snrnp35 T C 5: 124,490,490 I122T possibly damaging Het
Snx24 C T 18: 53,340,211 Q76* probably null Het
Sspo T A 6: 48,454,850 H692Q probably damaging Het
Stxbp3 T C 3: 108,793,798 D585G probably damaging Het
Svep1 T C 4: 58,072,677 N2211D possibly damaging Het
Tnfrsf18 G A 4: 156,028,424 probably null Het
Tnik T G 3: 28,541,972 D171E probably damaging Het
Ttc23l T A 15: 10,533,659 H266L probably damaging Het
Ttn G T 2: 76,894,770 S2037* probably null Het
Tuba3a G A 6: 125,281,310 T239I probably damaging Het
Usp25 T A 16: 77,093,706 D767E probably benign Het
Whrn G T 4: 63,431,843 H546N probably benign Het
Xirp2 C T 2: 67,511,162 T1249I probably damaging Het
Zbtb1 T A 12: 76,386,240 D333E probably damaging Het
Zfp689 T G 7: 127,448,815 E15A possibly damaging Het
Zhx3 A G 2: 160,779,868 M793T probably benign Het
Other mutations in Slc8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Slc8a1 APN 17 81649171 missense probably damaging 1.00
IGL00572:Slc8a1 APN 17 81388726 missense probably damaging 1.00
IGL00777:Slc8a1 APN 17 81648580 missense probably damaging 1.00
IGL00857:Slc8a1 APN 17 81647879 missense probably benign 0.03
IGL01068:Slc8a1 APN 17 81388942 missense probably benign 0.09
IGL01089:Slc8a1 APN 17 81648281 missense probably damaging 1.00
IGL01089:Slc8a1 APN 17 81388881 missense probably damaging 1.00
IGL01510:Slc8a1 APN 17 81648365 missense probably damaging 1.00
IGL01677:Slc8a1 APN 17 81648607 missense probably damaging 1.00
IGL01862:Slc8a1 APN 17 81442201 critical splice donor site probably null
IGL02003:Slc8a1 APN 17 81428196 missense possibly damaging 0.80
IGL02500:Slc8a1 APN 17 81388713 missense probably damaging 1.00
IGL02556:Slc8a1 APN 17 81648744 missense probably benign 0.24
IGL02800:Slc8a1 APN 17 81408323 missense probably benign 0.01
IGL03308:Slc8a1 APN 17 81442195 unclassified probably benign
IGL03391:Slc8a1 APN 17 81432638 splice site probably benign
cardinal UTSW 17 81648407 missense probably damaging 0.99
encyclical UTSW 17 81649454 missense probably damaging 1.00
PIT4498001:Slc8a1 UTSW 17 81648840 nonsense probably null
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0485:Slc8a1 UTSW 17 81647993 missense probably damaging 0.99
R0667:Slc8a1 UTSW 17 81648881 missense probably damaging 1.00
R0845:Slc8a1 UTSW 17 81437748 missense probably benign 0.05
R1073:Slc8a1 UTSW 17 81648407 missense probably damaging 0.99
R1417:Slc8a1 UTSW 17 81408280 missense probably damaging 1.00
R1510:Slc8a1 UTSW 17 81648118 missense probably damaging 1.00
R1546:Slc8a1 UTSW 17 81648247 missense probably damaging 1.00
R1625:Slc8a1 UTSW 17 81649241 missense probably damaging 1.00
R1806:Slc8a1 UTSW 17 81648487 missense probably damaging 1.00
R1879:Slc8a1 UTSW 17 81648013 missense probably damaging 1.00
R2025:Slc8a1 UTSW 17 81649112 missense probably damaging 1.00
R2187:Slc8a1 UTSW 17 81648553 missense possibly damaging 0.48
R2198:Slc8a1 UTSW 17 81408256 nonsense probably null
R3856:Slc8a1 UTSW 17 81648374 missense probably benign
R4067:Slc8a1 UTSW 17 81648274 missense probably damaging 1.00
R4224:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R4225:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R5028:Slc8a1 UTSW 17 81649273 missense possibly damaging 0.91
R5766:Slc8a1 UTSW 17 81648961 missense probably damaging 0.97
R5787:Slc8a1 UTSW 17 81388737 missense probably damaging 1.00
R5902:Slc8a1 UTSW 17 81408082 missense probably damaging 1.00
R5913:Slc8a1 UTSW 17 81648002 missense probably damaging 1.00
R6017:Slc8a1 UTSW 17 81648254 missense probably damaging 1.00
R6481:Slc8a1 UTSW 17 81388918 missense probably benign
R6670:Slc8a1 UTSW 17 81649454 missense probably damaging 1.00
R6714:Slc8a1 UTSW 17 81408249 missense probably damaging 1.00
R6914:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R6919:Slc8a1 UTSW 17 81388872 missense probably damaging 1.00
R6942:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R7057:Slc8a1 UTSW 17 81649095 missense probably damaging 1.00
R7431:Slc8a1 UTSW 17 81441663 missense probably benign 0.00
R7447:Slc8a1 UTSW 17 81649006 missense probably damaging 1.00
R7480:Slc8a1 UTSW 17 81649220 missense probably damaging 1.00
R7572:Slc8a1 UTSW 17 81441771 critical splice donor site probably null
R8056:Slc8a1 UTSW 17 81647923 missense probably damaging 1.00
R8326:Slc8a1 UTSW 17 81408106 missense probably damaging 0.98
R8782:Slc8a1 UTSW 17 81648013 missense probably damaging 1.00
R8905:Slc8a1 UTSW 17 81441655 missense probably benign 0.05
R8987:Slc8a1 UTSW 17 81647853 missense possibly damaging 0.79
R9057:Slc8a1 UTSW 17 81648050 missense probably benign
R9441:Slc8a1 UTSW 17 81649069 missense probably damaging 1.00
R9616:Slc8a1 UTSW 17 81647978 missense probably benign 0.25
R9657:Slc8a1 UTSW 17 81647815 missense probably damaging 1.00
X0024:Slc8a1 UTSW 17 81432762 missense probably benign 0.11
Z1186:Slc8a1 UTSW 17 81647882 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTAAACACAGAGTGCGATTATG -3'
(R):5'- AAGAAAGGGGTGATCTTGCCC -3'

Sequencing Primer
(F):5'- GATGAACATGTTAAAGGCAGCACTTC -3'
(R):5'- GGAACCCCAAGACCCATCTTTTG -3'
Posted On 2016-07-22