Mutagenetix > Incidental Mutations

Incidental Mutation 'R5309:Nup160'

404690

Institutional Source

Beutler Lab

Gene Symbol

Nup160

Ensembl Gene

ENSMUSG00000051329

Gene Name

nucleoporin 160

Synonyms

Gtl1-13, 2810011M03Rik

MMRRC Submission

042892-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R5309 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90677215-90736328 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 90732832 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1314 (E1314*)

Ref Sequence

ENSEMBL: ENSMUSP00000059289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057481]

Predicted Effect

probably null
Transcript: ENSMUST00000057481
AA Change: E1314*

SMART Domains

Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: E1314*

Domain	Start	End	E-Value	Type
Pfam:Nup160	28	543	9.9e-134	PFAM
low complexity region	695	710	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1302	1315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126503

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
A630073D07Rik	T	C	6: 132,626,577	Q72R	unknown	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abcg3	A	C	5: 104,936,599	C577G	possibly damaging	Het
Adamtsl5	A	T	10: 80,345,148		probably benign	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cdh3	A	G	8: 106,539,020	T232A	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Cwh43	A	G	5: 73,416,767	H258R	probably benign	Het
Cyp2j6	T	A	4: 96,535,556	I192F	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Egfr	G	A	11: 16,911,703	G1161S	probably benign	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Exoc7	C	A	11: 116,305,027	E28*	probably null	Het
Fam118a	C	T	15: 85,050,755	T195M	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gfm2	G	A	13: 97,163,151	A406T	probably damaging	Het
Gnal	G	A	18: 67,213,107	R219K	possibly damaging	Het
Helz2	T	A	2: 181,234,846	E1285V	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Ipo11	T	C	13: 106,833,973		probably benign	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Larp1	T	C	11: 58,050,808	V689A	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mmp9	T	A	2: 164,950,795		probably benign	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Osbpl8	T	A	10: 111,270,557	V275E	probably benign	Het
Osbpl9	A	G	4: 109,066,155	S520P	probably damaging	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Proz	T	C	8: 13,061,049	L7P	probably damaging	Het
Ptpn13	G	A	5: 103,541,053	S904N	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Shoc2	T	C	19: 53,987,733	V18A	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc10a6	A	T	5: 103,609,092	C269S	probably damaging	Het
Slc34a2	A	G	5: 53,069,488	E651G	probably damaging	Het
Snx13	C	T	12: 35,144,325	Q956*	probably null	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Srpk2	T	C	5: 23,525,718	K268E	probably damaging	Het
Supt16	T	C	14: 52,162,698	E996G	probably damaging	Het
Syf2	A	G	4: 134,936,069	D184G	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn1r170	T	A	7: 23,606,455	I94N	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Vmn2r15	T	A	5: 109,293,090	I301F	probably damaging	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Nup160

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Nup160	APN	2	90693106	missense	probably damaging	1.00
IGL00938:Nup160	APN	2	90732827	missense	probably damaging	1.00
IGL01111:Nup160	APN	2	90733209	missense	probably benign	0.00
IGL01140:Nup160	APN	2	90700565	missense	possibly damaging	0.85
IGL01348:Nup160	APN	2	90700428	missense	probably benign	0.05
IGL01361:Nup160	APN	2	90684012	nonsense	probably null
IGL01595:Nup160	APN	2	90729737	missense	probably damaging	1.00
IGL01791:Nup160	APN	2	90703853	missense	probably damaging	1.00
IGL02058:Nup160	APN	2	90729707	missense	probably damaging	1.00
IGL02147:Nup160	APN	2	90703941	missense	probably benign	0.17
IGL02250:Nup160	APN	2	90708870	missense	probably damaging	1.00
IGL02507:Nup160	APN	2	90729735	missense	probably benign	0.08
IGL03108:Nup160	APN	2	90703825	missense	probably benign
R0031:Nup160	UTSW	2	90717587	splice site	probably null
R0365:Nup160	UTSW	2	90708844	missense	probably benign	0.01
R0417:Nup160	UTSW	2	90735427	missense	possibly damaging	0.93
R0781:Nup160	UTSW	2	90733219	splice site	probably benign
R1037:Nup160	UTSW	2	90693902	missense	probably damaging	1.00
R1110:Nup160	UTSW	2	90733219	splice site	probably benign
R1459:Nup160	UTSW	2	90690150	missense	probably damaging	1.00
R1468:Nup160	UTSW	2	90700543	missense	probably benign
R1468:Nup160	UTSW	2	90700543	missense	probably benign
R1478:Nup160	UTSW	2	90679399	start gained	probably benign
R1565:Nup160	UTSW	2	90722061	missense	possibly damaging	0.62
R1617:Nup160	UTSW	2	90679499	missense	probably benign
R1647:Nup160	UTSW	2	90710088	missense	probably damaging	0.99
R1648:Nup160	UTSW	2	90710088	missense	probably damaging	0.99
R1702:Nup160	UTSW	2	90683958	missense	probably damaging	0.96
R1719:Nup160	UTSW	2	90700436	nonsense	probably null
R2448:Nup160	UTSW	2	90722057	missense	probably damaging	1.00
R3775:Nup160	UTSW	2	90722076	missense	probably benign
R3776:Nup160	UTSW	2	90722076	missense	probably benign
R4600:Nup160	UTSW	2	90685197	critical splice donor site	probably null
R4812:Nup160	UTSW	2	90725691	missense	probably damaging	1.00
R5075:Nup160	UTSW	2	90700174	missense	probably damaging	0.99
R5312:Nup160	UTSW	2	90732832	nonsense	probably null
R5447:Nup160	UTSW	2	90725615	missense	possibly damaging	0.82
R5682:Nup160	UTSW	2	90679811	missense	probably benign	0.29
R5726:Nup160	UTSW	2	90717851	missense	probably damaging	1.00
R5771:Nup160	UTSW	2	90723396	missense	probably damaging	1.00
R5825:Nup160	UTSW	2	90679770	critical splice acceptor site	probably null
R5851:Nup160	UTSW	2	90707038	missense	probably benign
R5988:Nup160	UTSW	2	90689209	missense	probably damaging	1.00
R6151:Nup160	UTSW	2	90690105	nonsense	probably null
R6164:Nup160	UTSW	2	90717876	nonsense	probably null
R6356:Nup160	UTSW	2	90711935	splice site	probably null
R6379:Nup160	UTSW	2	90702409	nonsense	probably null
R6519:Nup160	UTSW	2	90718217	missense	probably damaging	0.99
R6755:Nup160	UTSW	2	90700456	missense	probably damaging	1.00
R6989:Nup160	UTSW	2	90707020	missense	probably benign	0.34
R7251:Nup160	UTSW	2	90700174	missense	probably damaging	0.99
R7256:Nup160	UTSW	2	90723355	missense	probably damaging	1.00
R7353:Nup160	UTSW	2	90703952	missense	probably damaging	0.99
R7546:Nup160	UTSW	2	90685058	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGCCTAGATGTGTACTG -3'
(R):5'- CCATTCTGAAATTAGGTGGGGCTG -3'

Sequencing Primer
(F):5'- CCTGCCTAGATGTGTACTGTATAAG -3'
(R):5'- GCTGGTGAGATAGCAAAGGC -3'

Posted On

2016-07-22