Incidental Mutation 'R5309:Mmp9'
ID404693
Institutional Source Beutler Lab
Gene Symbol Mmp9
Ensembl Gene ENSMUSG00000017737
Gene Namematrix metallopeptidase 9
Synonymsgelatinase B, MMP-9, Gelatinase B, B/MMP9, Gel B, Clg4b
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164940780-164955850 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 164950795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017881] [ENSMUST00000137626]
Predicted Effect probably benign
Transcript: ENSMUST00000017881
SMART Domains Protein: ENSMUSP00000017881
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 39 95 2.9e-8 PFAM
ZnMc 112 445 3.92e-39 SMART
FN2 223 271 8.08e-29 SMART
FN2 281 329 6.93e-28 SMART
FN2 340 388 9.28e-29 SMART
low complexity region 449 468 N/A INTRINSIC
Pfam:PT 474 508 1.1e-11 PFAM
HX 539 583 2.4e-8 SMART
HX 585 626 9.33e-6 SMART
HX 631 677 2.74e-3 SMART
HX 679 721 1.74e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134382
Predicted Effect probably benign
Transcript: ENSMUST00000137626
SMART Domains Protein: ENSMUSP00000120628
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1L6J|A 20 67 5e-15 PDB
SCOP:d1l6ja1 29 67 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144917
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens of type IV, V and XI, and elastin. Mice lacking the encoded protein exhibit an abnormal pattern of skeletal growth plate vascularization and ossification, reduced keratinocyte hyperproliferation at all neoplastic stages, a decreased incidence of invasive tumors, and resistance to experimental autoimmune encephalomyelitis. [provided by RefSeq, Feb 2016]
PHENOTYPE: Null mutants have short long bones with compensatory growth via delayed ossification and apoptosis of hypertrophic chondroctyes. Mutants are protected against ischemic brain injury, damage caused by myocardial infarction, and allergic airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Mmp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Mmp9 APN 2 164949989 missense probably benign 0.13
IGL01980:Mmp9 APN 2 164950916 missense probably benign 0.01
IGL02117:Mmp9 APN 2 164949724 missense probably damaging 1.00
IGL02515:Mmp9 APN 2 164948956 missense probably damaging 1.00
IGL02756:Mmp9 APN 2 164949315 missense probably benign 0.27
IGL02833:Mmp9 APN 2 164949803 missense probably damaging 1.00
IGL02893:Mmp9 APN 2 164949068 splice site probably null
IGL02949:Mmp9 APN 2 164951119 missense probably damaging 1.00
IGL03097:Mmp9 UTSW 2 164950806 intron probably null
R0001:Mmp9 UTSW 2 164948383 missense probably benign 0.02
R0125:Mmp9 UTSW 2 164951257 missense probably damaging 1.00
R0532:Mmp9 UTSW 2 164949820 nonsense probably null
R1300:Mmp9 UTSW 2 164948956 missense probably damaging 1.00
R1341:Mmp9 UTSW 2 164949327 missense probably damaging 1.00
R1366:Mmp9 UTSW 2 164953342 missense probably damaging 1.00
R1711:Mmp9 UTSW 2 164949422 missense probably damaging 1.00
R2138:Mmp9 UTSW 2 164952467 nonsense probably null
R3405:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R3406:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R4460:Mmp9 UTSW 2 164949038 missense probably damaging 0.99
R4655:Mmp9 UTSW 2 164951202 missense probably benign 0.29
R5155:Mmp9 UTSW 2 164949066 critical splice donor site probably null
R5355:Mmp9 UTSW 2 164950992 missense possibly damaging 0.76
R5476:Mmp9 UTSW 2 164952494 missense probably benign
R5505:Mmp9 UTSW 2 164953608 missense probably benign 0.34
R5646:Mmp9 UTSW 2 164949050 missense probably benign 0.00
R5725:Mmp9 UTSW 2 164949336 missense possibly damaging 0.93
R6968:Mmp9 UTSW 2 164952940 missense probably benign
R7082:Mmp9 UTSW 2 164948892 missense probably benign 0.25
R7822:Mmp9 UTSW 2 164949036 nonsense probably null
X0020:Mmp9 UTSW 2 164950373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTGGTCTCTAAAGGTGGC -3'
(R):5'- TTGGTCTGGACAGAAACCCC -3'

Sequencing Primer
(F):5'- CATTGGTCTCTAAAGGTGGCTTTTCC -3'
(R):5'- AGAAACCCCACTTCTTGTCAGTG -3'
Posted On2016-07-22