Incidental Mutation 'R5309:Cyp2j6'
ID404702
Institutional Source Beutler Lab
Gene Symbol Cyp2j6
Ensembl Gene ENSMUSG00000052914
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 6
Synonyms
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96516138-96553661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96535556 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 192 (I192F)
Ref Sequence ENSEMBL: ENSMUSP00000030303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030303]
Predicted Effect probably damaging
Transcript: ENSMUST00000030303
AA Change: I192F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030303
Gene: ENSMUSG00000052914
AA Change: I192F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 497 6.6e-138 PFAM
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Cyp2j6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Cyp2j6 APN 4 96536046 missense possibly damaging 0.78
IGL01543:Cyp2j6 APN 4 96525924 missense possibly damaging 0.78
IGL02324:Cyp2j6 APN 4 96525933 missense probably damaging 0.99
IGL02727:Cyp2j6 APN 4 96545764 missense probably benign
IGL02963:Cyp2j6 APN 4 96518184 missense probably damaging 1.00
IGL03099:Cyp2j6 APN 4 96536091 missense possibly damaging 0.65
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0376:Cyp2j6 UTSW 4 96526023 missense probably damaging 0.99
R0448:Cyp2j6 UTSW 4 96545728 missense probably benign
R0471:Cyp2j6 UTSW 4 96531748 nonsense probably null
R0734:Cyp2j6 UTSW 4 96523844 splice site probably benign
R1497:Cyp2j6 UTSW 4 96531661 missense probably damaging 1.00
R1686:Cyp2j6 UTSW 4 96523777 missense probably benign 0.08
R2079:Cyp2j6 UTSW 4 96531725 missense possibly damaging 0.87
R2293:Cyp2j6 UTSW 4 96529433 missense possibly damaging 0.87
R2350:Cyp2j6 UTSW 4 96529408 missense probably damaging 1.00
R2971:Cyp2j6 UTSW 4 96531781 missense probably benign 0.06
R3927:Cyp2j6 UTSW 4 96553288 missense probably benign 0.15
R4020:Cyp2j6 UTSW 4 96518170 missense probably benign 0.03
R5087:Cyp2j6 UTSW 4 96531699 missense probably damaging 0.99
R5861:Cyp2j6 UTSW 4 96545803 missense possibly damaging 0.81
R5882:Cyp2j6 UTSW 4 96535602 missense probably benign 0.00
R6123:Cyp2j6 UTSW 4 96518029 makesense probably null
R6180:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6181:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6182:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6185:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6186:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6217:Cyp2j6 UTSW 4 96518161 missense probably damaging 1.00
R6784:Cyp2j6 UTSW 4 96535504 missense possibly damaging 0.70
R7038:Cyp2j6 UTSW 4 96535471 missense probably benign
R7146:Cyp2j6 UTSW 4 96545782 missense probably damaging 1.00
R7379:Cyp2j6 UTSW 4 96525946 missense probably damaging 0.99
R7470:Cyp2j6 UTSW 4 96535471 missense probably benign
R7536:Cyp2j6 UTSW 4 96535537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCCAGCAGTTACATATGTATG -3'
(R):5'- TGACCAGGGCCTCTTACATG -3'

Sequencing Primer
(F):5'- CCTACCCTTCAAAGATATGC -3'
(R):5'- AGGGCCTCTTACATGTGTATTTC -3'
Posted On2016-07-22