Incidental Mutation 'R5309:Srpk2'
ID404706
Institutional Source Beutler Lab
Gene Symbol Srpk2
Ensembl Gene ENSMUSG00000062604
Gene Nameserine/arginine-rich protein specific kinase 2
SynonymsWBP6, mSRPK2
MMRRC Submission 042892-MU
Accession Numbers

NCBI RefSeq: NM_009274.2; MGI:1201408

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23503264-23684617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23525718 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 268 (K268E)
Ref Sequence ENSEMBL: ENSMUSP00000085734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000196388] [ENSMUST00000196929]
Predicted Effect probably damaging
Transcript: ENSMUST00000088392
AA Change: K268E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604
AA Change: K268E

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196388
SMART Domains Protein: ENSMUSP00000143453
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
S_TKc 3 129 7.2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196929
SMART Domains Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 131 2.6e-8 PFAM
Pfam:Pkinase 2 130 2.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200173
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(3) Gene trapped(36)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Srpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Srpk2 APN 5 23540379 missense probably benign 0.10
IGL02057:Srpk2 APN 5 23518707 missense probably damaging 0.99
IGL02217:Srpk2 APN 5 23545570 missense probably damaging 1.00
IGL03115:Srpk2 APN 5 23524618 splice site probably null
FR4737:Srpk2 UTSW 5 23545196 unclassified probably null
P0008:Srpk2 UTSW 5 23513978 missense probably damaging 1.00
R0142:Srpk2 UTSW 5 23527930 missense probably damaging 0.97
R0462:Srpk2 UTSW 5 23518426 missense probably damaging 1.00
R0992:Srpk2 UTSW 5 23545543 missense probably damaging 0.99
R1569:Srpk2 UTSW 5 23514026 missense probably damaging 1.00
R1677:Srpk2 UTSW 5 23525750 splice site probably null
R1696:Srpk2 UTSW 5 23548494 nonsense probably null
R1752:Srpk2 UTSW 5 23528019 missense probably damaging 1.00
R1862:Srpk2 UTSW 5 23524150 missense probably benign 0.32
R1989:Srpk2 UTSW 5 23518423 missense probably damaging 1.00
R2173:Srpk2 UTSW 5 23518615 splice site probably null
R4096:Srpk2 UTSW 5 23540502 intron probably benign
R4271:Srpk2 UTSW 5 23548515 missense possibly damaging 0.95
R4894:Srpk2 UTSW 5 23545529 missense probably damaging 1.00
R5043:Srpk2 UTSW 5 23524517 missense probably benign
R5044:Srpk2 UTSW 5 23524392 missense possibly damaging 0.91
R5478:Srpk2 UTSW 5 23524183 missense possibly damaging 0.71
R5568:Srpk2 UTSW 5 23525699 missense possibly damaging 0.73
R5665:Srpk2 UTSW 5 23518477 missense probably damaging 0.99
R5678:Srpk2 UTSW 5 23524606 frame shift probably null
R6364:Srpk2 UTSW 5 23540467 missense probably damaging 1.00
R7201:Srpk2 UTSW 5 23507628 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGTCGGCTGCTTTCAGTGTC -3'
(R):5'- TACTAACAGTCTGAGCCCAGCC -3'

Sequencing Primer
(F):5'- TGTCACCTCCGGCTGGTAC -3'
(R):5'- CCTAAGGTGGCTCTTCTGGC -3'
Posted On2016-07-22