Incidental Mutation 'R0009:Herc2'
ID 40471
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms D7H15F32S1, D7H15F37S1, D15F32S1h, rjs, jdf2
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R0009 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 55699944-55881548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55857560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 4048 (S4048P)
Ref Sequence ENSEMBL: ENSMUSP00000131573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000076226
AA Change: S4048P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: S4048P

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164095
AA Change: S4048P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: S4048P

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205303
AA Change: S4012P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.7228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,482 (GRCm39) probably benign Het
Abcg4 T G 9: 44,188,946 (GRCm39) probably benign Het
Afm C A 5: 90,693,243 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aplnr T A 2: 84,967,620 (GRCm39) probably null Het
Arih2 T A 9: 108,488,926 (GRCm39) H264L probably damaging Het
Atp1a1 A T 3: 101,487,151 (GRCm39) I886N possibly damaging Het
Bmf A T 2: 118,380,103 (GRCm39) V14E probably damaging Het
Ccdc116 T C 16: 16,961,903 (GRCm39) E15G probably damaging Het
Ccdc175 T C 12: 72,182,739 (GRCm39) N427D possibly damaging Het
Cfap53 A G 18: 74,432,247 (GRCm39) H45R probably benign Het
Chd3 A G 11: 69,240,732 (GRCm39) L1569P probably damaging Het
Cntn2 G A 1: 132,443,918 (GRCm39) Q457* probably null Het
Coro1a A T 7: 126,300,585 (GRCm39) probably benign Het
Cracr2b T A 7: 141,043,672 (GRCm39) L91Q probably damaging Het
Ctdspl T C 9: 118,849,114 (GRCm39) probably null Het
Dip2b T A 15: 100,067,193 (GRCm39) L565Q probably damaging Het
Dip2c T A 13: 9,671,939 (GRCm39) C1004S probably damaging Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah14 A G 1: 181,596,972 (GRCm39) probably benign Het
Dnase1 T C 16: 3,856,810 (GRCm39) V147A probably damaging Het
Dusp8 T C 7: 141,635,791 (GRCm39) probably benign Het
Fer1l6 T C 15: 58,534,636 (GRCm39) Y1828H probably damaging Het
Flvcr1 A G 1: 190,740,388 (GRCm39) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm39) V311A probably benign Het
Glud1 G A 14: 34,056,225 (GRCm39) G300S probably benign Het
Gm4847 C T 1: 166,458,055 (GRCm39) V433I probably benign Het
Gstm3 T G 3: 107,875,156 (GRCm39) Y62S probably damaging Het
Gtse1 C T 15: 85,746,636 (GRCm39) P151S probably benign Het
Hp1bp3 T A 4: 137,948,994 (GRCm39) I19K probably benign Het
Htr7 C A 19: 36,018,940 (GRCm39) probably benign Het
Il1a C T 2: 129,150,994 (GRCm39) D10N probably damaging Het
Il22ra2 A T 10: 19,500,206 (GRCm39) N39I probably damaging Het
Kcnn4 T C 7: 24,078,680 (GRCm39) C267R possibly damaging Het
Larp1 A G 11: 57,946,299 (GRCm39) K879R possibly damaging Het
Lcn5 T A 2: 25,551,417 (GRCm39) probably benign Het
Lep T A 6: 29,068,971 (GRCm39) C7* probably null Het
Magi2 A T 5: 20,816,053 (GRCm39) Y747F probably benign Het
Mast4 T C 13: 102,878,566 (GRCm39) T1223A probably damaging Het
Mcc C T 18: 44,579,000 (GRCm39) E803K probably damaging Het
Mtmr4 T C 11: 87,502,334 (GRCm39) I796T probably benign Het
Myef2 A T 2: 124,950,898 (GRCm39) D312E probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo19 T A 11: 84,778,995 (GRCm39) probably null Het
Naa15 T G 3: 51,377,640 (GRCm39) H763Q probably damaging Het
Pde5a C T 3: 122,618,551 (GRCm39) probably benign Het
Plpp2 C T 10: 79,363,078 (GRCm39) R184H probably benign Het
Rab19 T G 6: 39,366,621 (GRCm39) L179V probably damaging Het
Rims2 T A 15: 39,398,362 (GRCm39) M1087K probably damaging Het
Riox2 C A 16: 59,309,730 (GRCm39) D361E probably benign Het
Sh3rf1 T A 8: 61,679,327 (GRCm39) V123E probably damaging Het
Slc35e1 A T 8: 73,238,553 (GRCm39) N318K probably damaging Het
Slc9a2 A T 1: 40,802,762 (GRCm39) E604V probably benign Het
Srp72 T C 5: 77,135,732 (GRCm39) S221P probably damaging Het
Tbx19 A T 1: 164,988,089 (GRCm39) S15T possibly damaging Het
Tcea2 A G 2: 181,327,610 (GRCm39) T112A probably benign Het
Tesk1 T A 4: 43,445,368 (GRCm39) D230E probably damaging Het
Tm4sf5 C T 11: 70,401,538 (GRCm39) A179V probably damaging Het
Tnr G T 1: 159,679,986 (GRCm39) G320V probably damaging Het
Trappc11 A T 8: 47,956,355 (GRCm39) C874S possibly damaging Het
Trpm3 T A 19: 22,891,810 (GRCm39) Y885N probably damaging Het
Unc5a T A 13: 55,150,692 (GRCm39) C505S probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Xpo5 T C 17: 46,515,712 (GRCm39) probably benign Het
Zfp637 C A 6: 117,822,629 (GRCm39) H252Q probably damaging Het
Zfp646 T A 7: 127,479,903 (GRCm39) D693E probably damaging Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 55,774,047 (GRCm39) missense probably damaging 1.00
IGL00529:Herc2 APN 7 55,807,501 (GRCm39) missense probably benign
IGL00548:Herc2 APN 7 55,856,313 (GRCm39) missense probably benign 0.20
IGL00970:Herc2 APN 7 55,830,812 (GRCm39) splice site probably benign
IGL01141:Herc2 APN 7 55,862,589 (GRCm39) missense possibly damaging 0.47
IGL01147:Herc2 APN 7 55,806,697 (GRCm39) missense probably benign 0.43
IGL01150:Herc2 APN 7 55,830,881 (GRCm39) missense probably damaging 1.00
IGL01519:Herc2 APN 7 55,753,698 (GRCm39) missense probably damaging 1.00
IGL01576:Herc2 APN 7 55,876,409 (GRCm39) critical splice donor site probably null
IGL01626:Herc2 APN 7 55,734,890 (GRCm39) missense probably benign 0.02
IGL01658:Herc2 APN 7 55,809,200 (GRCm39) missense probably damaging 1.00
IGL01707:Herc2 APN 7 55,814,935 (GRCm39) missense probably damaging 1.00
IGL01727:Herc2 APN 7 55,787,554 (GRCm39) missense probably damaging 1.00
IGL01935:Herc2 APN 7 55,803,541 (GRCm39) missense probably benign
IGL01969:Herc2 APN 7 55,835,579 (GRCm39) splice site probably benign
IGL02074:Herc2 APN 7 55,737,192 (GRCm39) splice site probably benign
IGL02261:Herc2 APN 7 55,856,492 (GRCm39) missense probably damaging 0.99
IGL02339:Herc2 APN 7 55,771,470 (GRCm39) missense probably benign 0.01
IGL02353:Herc2 APN 7 55,764,560 (GRCm39) missense probably damaging 1.00
IGL02360:Herc2 APN 7 55,764,560 (GRCm39) missense probably damaging 1.00
IGL02409:Herc2 APN 7 55,870,217 (GRCm39) splice site probably null
IGL02528:Herc2 APN 7 55,758,641 (GRCm39) splice site probably benign
IGL02571:Herc2 APN 7 55,803,134 (GRCm39) missense probably damaging 1.00
IGL02578:Herc2 APN 7 55,756,283 (GRCm39) splice site probably null
IGL02661:Herc2 APN 7 55,762,821 (GRCm39) missense probably damaging 1.00
IGL02664:Herc2 APN 7 55,785,426 (GRCm39) nonsense probably null
IGL02675:Herc2 APN 7 55,813,849 (GRCm39) missense probably damaging 0.99
IGL02689:Herc2 APN 7 55,815,031 (GRCm39) splice site probably benign
IGL02710:Herc2 APN 7 55,787,562 (GRCm39) missense possibly damaging 0.95
IGL02750:Herc2 APN 7 55,854,127 (GRCm39) splice site probably benign
IGL02754:Herc2 APN 7 55,747,246 (GRCm39) missense probably damaging 1.00
IGL03029:Herc2 APN 7 55,818,715 (GRCm39) missense probably damaging 1.00
IGL03039:Herc2 APN 7 55,818,769 (GRCm39) splice site probably benign
IGL03082:Herc2 APN 7 55,835,671 (GRCm39) missense probably benign 0.19
IGL03090:Herc2 APN 7 55,854,221 (GRCm39) missense probably damaging 0.96
IGL03154:Herc2 APN 7 55,851,907 (GRCm39) missense probably damaging 1.00
IGL03165:Herc2 APN 7 55,841,660 (GRCm39) missense probably damaging 1.00
IGL03201:Herc2 APN 7 55,869,516 (GRCm39) missense probably damaging 1.00
IGL03234:Herc2 APN 7 55,753,610 (GRCm39) missense probably damaging 1.00
IGL03293:Herc2 APN 7 55,804,878 (GRCm39) missense probably benign 0.43
IGL03331:Herc2 APN 7 55,785,015 (GRCm39) splice site probably benign
IGL03340:Herc2 APN 7 55,740,668 (GRCm39) missense possibly damaging 0.51
IGL03409:Herc2 APN 7 55,878,317 (GRCm39) missense probably damaging 1.00
alarmed UTSW 7 55,879,410 (GRCm39) missense possibly damaging 0.92
hyper UTSW 7 55,809,165 (GRCm39) missense probably damaging 1.00
R0798_herc2_487 UTSW 7 55,785,431 (GRCm39) critical splice donor site probably null
R1370_Herc2_948 UTSW 7 55,818,621 (GRCm39) missense probably benign 0.01
R2030_Herc2_144 UTSW 7 55,834,121 (GRCm39) missense probably damaging 0.99
uptight UTSW 7 55,762,958 (GRCm39) missense probably damaging 1.00
I0000:Herc2 UTSW 7 55,786,477 (GRCm39) splice site probably benign
PIT1430001:Herc2 UTSW 7 55,876,702 (GRCm39) missense probably damaging 1.00
R0009:Herc2 UTSW 7 55,857,560 (GRCm39) missense probably benign 0.03
R0058:Herc2 UTSW 7 55,820,231 (GRCm39) missense possibly damaging 0.93
R0114:Herc2 UTSW 7 55,803,522 (GRCm39) splice site probably benign
R0117:Herc2 UTSW 7 55,863,359 (GRCm39) splice site probably benign
R0141:Herc2 UTSW 7 55,771,309 (GRCm39) missense probably benign 0.17
R0266:Herc2 UTSW 7 55,856,326 (GRCm39) missense probably damaging 1.00
R0401:Herc2 UTSW 7 55,807,480 (GRCm39) missense probably damaging 0.99
R0403:Herc2 UTSW 7 55,809,165 (GRCm39) missense probably damaging 1.00
R0437:Herc2 UTSW 7 55,869,563 (GRCm39) nonsense probably null
R0491:Herc2 UTSW 7 55,772,114 (GRCm39) missense possibly damaging 0.54
R0499:Herc2 UTSW 7 55,834,117 (GRCm39) nonsense probably null
R0580:Herc2 UTSW 7 55,788,539 (GRCm39) missense probably damaging 1.00
R0650:Herc2 UTSW 7 55,762,958 (GRCm39) missense probably damaging 1.00
R0744:Herc2 UTSW 7 55,855,784 (GRCm39) splice site probably benign
R0798:Herc2 UTSW 7 55,785,431 (GRCm39) critical splice donor site probably null
R0842:Herc2 UTSW 7 55,771,453 (GRCm39) missense probably benign
R0849:Herc2 UTSW 7 55,856,326 (GRCm39) missense probably damaging 1.00
R0850:Herc2 UTSW 7 55,854,231 (GRCm39) missense probably benign 0.09
R0926:Herc2 UTSW 7 55,782,296 (GRCm39) missense possibly damaging 0.67
R1146:Herc2 UTSW 7 55,796,444 (GRCm39) missense probably benign
R1146:Herc2 UTSW 7 55,796,444 (GRCm39) missense probably benign
R1292:Herc2 UTSW 7 55,846,951 (GRCm39) missense probably benign 0.05
R1370:Herc2 UTSW 7 55,818,621 (GRCm39) missense probably benign 0.01
R1443:Herc2 UTSW 7 55,854,481 (GRCm39) missense possibly damaging 0.69
R1445:Herc2 UTSW 7 55,818,744 (GRCm39) missense probably damaging 1.00
R1541:Herc2 UTSW 7 55,785,405 (GRCm39) missense probably damaging 1.00
R1550:Herc2 UTSW 7 55,785,406 (GRCm39) missense probably damaging 1.00
R1551:Herc2 UTSW 7 55,796,417 (GRCm39) missense probably benign 0.01
R1633:Herc2 UTSW 7 55,879,117 (GRCm39) missense probably null 1.00
R1635:Herc2 UTSW 7 55,786,415 (GRCm39) missense probably benign 0.00
R1659:Herc2 UTSW 7 55,784,853 (GRCm39) missense probably benign 0.00
R1682:Herc2 UTSW 7 55,738,148 (GRCm39) missense possibly damaging 0.87
R1697:Herc2 UTSW 7 55,803,653 (GRCm39) missense probably benign 0.43
R1748:Herc2 UTSW 7 55,798,571 (GRCm39) critical splice donor site probably null
R1802:Herc2 UTSW 7 55,834,080 (GRCm39) missense probably damaging 1.00
R1835:Herc2 UTSW 7 55,856,513 (GRCm39) nonsense probably null
R1836:Herc2 UTSW 7 55,804,853 (GRCm39) nonsense probably null
R1872:Herc2 UTSW 7 55,807,257 (GRCm39) missense probably benign 0.18
R1889:Herc2 UTSW 7 55,839,561 (GRCm39) missense possibly damaging 0.60
R1906:Herc2 UTSW 7 55,764,612 (GRCm39) missense probably benign 0.01
R2004:Herc2 UTSW 7 55,787,607 (GRCm39) missense probably damaging 1.00
R2030:Herc2 UTSW 7 55,834,121 (GRCm39) missense probably damaging 0.99
R2037:Herc2 UTSW 7 55,855,709 (GRCm39) missense probably damaging 1.00
R2059:Herc2 UTSW 7 55,813,645 (GRCm39) missense probably damaging 1.00
R2068:Herc2 UTSW 7 55,782,245 (GRCm39) missense probably damaging 1.00
R2072:Herc2 UTSW 7 55,876,712 (GRCm39) missense probably damaging 1.00
R2085:Herc2 UTSW 7 55,862,713 (GRCm39) missense possibly damaging 0.94
R2115:Herc2 UTSW 7 55,835,576 (GRCm39) splice site probably benign
R2160:Herc2 UTSW 7 55,862,670 (GRCm39) missense probably benign 0.00
R2173:Herc2 UTSW 7 55,835,699 (GRCm39) missense probably benign 0.27
R2221:Herc2 UTSW 7 55,818,766 (GRCm39) critical splice donor site probably null
R2280:Herc2 UTSW 7 55,787,019 (GRCm39) missense possibly damaging 0.79
R3078:Herc2 UTSW 7 55,786,991 (GRCm39) missense probably benign
R3104:Herc2 UTSW 7 55,785,103 (GRCm39) missense probably benign 0.23
R3177:Herc2 UTSW 7 55,803,176 (GRCm39) missense probably benign 0.00
R3277:Herc2 UTSW 7 55,803,176 (GRCm39) missense probably benign 0.00
R3766:Herc2 UTSW 7 55,813,572 (GRCm39) missense probably damaging 1.00
R3770:Herc2 UTSW 7 55,814,755 (GRCm39) missense probably benign
R3807:Herc2 UTSW 7 55,857,557 (GRCm39) missense probably damaging 1.00
R3912:Herc2 UTSW 7 55,748,185 (GRCm39) missense probably damaging 0.98
R4004:Herc2 UTSW 7 55,756,213 (GRCm39) missense possibly damaging 0.53
R4039:Herc2 UTSW 7 55,806,159 (GRCm39) missense probably damaging 0.98
R4190:Herc2 UTSW 7 55,772,196 (GRCm39) missense probably benign 0.03
R4225:Herc2 UTSW 7 55,814,735 (GRCm39) missense probably damaging 1.00
R4334:Herc2 UTSW 7 55,876,402 (GRCm39) missense probably damaging 1.00
R4405:Herc2 UTSW 7 55,820,225 (GRCm39) missense probably damaging 1.00
R4448:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4450:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4565:Herc2 UTSW 7 55,803,586 (GRCm39) missense possibly damaging 0.71
R4667:Herc2 UTSW 7 55,781,001 (GRCm39) missense probably damaging 1.00
R4747:Herc2 UTSW 7 55,756,141 (GRCm39) missense possibly damaging 0.80
R4762:Herc2 UTSW 7 55,820,388 (GRCm39) missense probably benign 0.19
R4829:Herc2 UTSW 7 55,756,240 (GRCm39) missense probably benign 0.39
R4832:Herc2 UTSW 7 55,748,165 (GRCm39) nonsense probably null
R4895:Herc2 UTSW 7 55,872,734 (GRCm39) missense probably damaging 1.00
R4904:Herc2 UTSW 7 55,807,234 (GRCm39) missense probably damaging 0.99
R4908:Herc2 UTSW 7 55,827,660 (GRCm39) missense probably benign 0.01
R4911:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4921:Herc2 UTSW 7 55,879,438 (GRCm39) missense probably benign 0.04
R4939:Herc2 UTSW 7 55,856,484 (GRCm39) missense probably damaging 1.00
R5155:Herc2 UTSW 7 55,877,574 (GRCm39) missense possibly damaging 0.85
R5184:Herc2 UTSW 7 55,772,099 (GRCm39) missense probably damaging 1.00
R5269:Herc2 UTSW 7 55,818,618 (GRCm39) nonsense probably null
R5306:Herc2 UTSW 7 55,834,709 (GRCm39) missense probably damaging 1.00
R5314:Herc2 UTSW 7 55,869,534 (GRCm39) missense probably damaging 0.99
R5369:Herc2 UTSW 7 55,832,448 (GRCm39) missense probably damaging 1.00
R5418:Herc2 UTSW 7 55,787,313 (GRCm39) missense probably damaging 1.00
R5420:Herc2 UTSW 7 55,853,578 (GRCm39) missense probably damaging 0.96
R5463:Herc2 UTSW 7 55,844,010 (GRCm39) missense probably damaging 1.00
R5510:Herc2 UTSW 7 55,856,519 (GRCm39) missense probably damaging 1.00
R5634:Herc2 UTSW 7 55,856,531 (GRCm39) missense probably damaging 1.00
R5638:Herc2 UTSW 7 55,854,164 (GRCm39) missense probably benign 0.01
R5690:Herc2 UTSW 7 55,807,453 (GRCm39) missense probably benign
R5762:Herc2 UTSW 7 55,846,938 (GRCm39) missense possibly damaging 0.68
R5807:Herc2 UTSW 7 55,880,667 (GRCm39) missense probably damaging 0.99
R5878:Herc2 UTSW 7 55,773,996 (GRCm39) missense probably benign
R6036:Herc2 UTSW 7 55,717,801 (GRCm39) missense probably benign 0.01
R6036:Herc2 UTSW 7 55,717,801 (GRCm39) missense probably benign 0.01
R6083:Herc2 UTSW 7 55,878,253 (GRCm39) missense probably benign 0.00
R6192:Herc2 UTSW 7 55,857,510 (GRCm39) missense probably damaging 1.00
R6193:Herc2 UTSW 7 55,806,649 (GRCm39) missense probably damaging 0.98
R6261:Herc2 UTSW 7 55,846,820 (GRCm39) nonsense probably null
R6267:Herc2 UTSW 7 55,802,914 (GRCm39) nonsense probably null
R6267:Herc2 UTSW 7 55,854,466 (GRCm39) missense possibly damaging 0.51
R6298:Herc2 UTSW 7 55,841,013 (GRCm39) missense probably benign
R6299:Herc2 UTSW 7 55,784,803 (GRCm39) missense possibly damaging 0.47
R6326:Herc2 UTSW 7 55,872,682 (GRCm39) missense probably damaging 0.98
R6347:Herc2 UTSW 7 55,844,151 (GRCm39) critical splice donor site probably null
R6394:Herc2 UTSW 7 55,865,729 (GRCm39) missense probably damaging 1.00
R6500:Herc2 UTSW 7 55,796,393 (GRCm39) nonsense probably null
R6526:Herc2 UTSW 7 55,807,078 (GRCm39) missense probably damaging 0.99
R6592:Herc2 UTSW 7 55,857,438 (GRCm39) critical splice acceptor site probably null
R6619:Herc2 UTSW 7 55,717,840 (GRCm39) nonsense probably null
R6719:Herc2 UTSW 7 55,862,574 (GRCm39) missense probably damaging 1.00
R6750:Herc2 UTSW 7 55,747,195 (GRCm39) missense probably damaging 1.00
R6807:Herc2 UTSW 7 55,814,670 (GRCm39) missense probably damaging 1.00
R6811:Herc2 UTSW 7 55,763,181 (GRCm39) nonsense probably null
R6837:Herc2 UTSW 7 55,839,589 (GRCm39) missense possibly damaging 0.89
R6838:Herc2 UTSW 7 55,758,526 (GRCm39) missense probably damaging 1.00
R6902:Herc2 UTSW 7 55,785,234 (GRCm39) missense probably benign 0.37
R6983:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6985:Herc2 UTSW 7 55,782,228 (GRCm39) missense probably damaging 1.00
R6985:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6986:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6987:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R7113:Herc2 UTSW 7 55,853,597 (GRCm39) missense probably damaging 0.99
R7173:Herc2 UTSW 7 55,853,575 (GRCm39) missense probably damaging 1.00
R7202:Herc2 UTSW 7 55,781,034 (GRCm39) missense probably damaging 0.99
R7205:Herc2 UTSW 7 55,832,388 (GRCm39) missense probably damaging 1.00
R7236:Herc2 UTSW 7 55,734,828 (GRCm39) missense probably benign 0.29
R7297:Herc2 UTSW 7 55,786,406 (GRCm39) missense probably benign 0.00
R7358:Herc2 UTSW 7 55,832,423 (GRCm39) missense possibly damaging 0.48
R7438:Herc2 UTSW 7 55,753,466 (GRCm39) splice site probably null
R7537:Herc2 UTSW 7 55,869,527 (GRCm39) nonsense probably null
R7578:Herc2 UTSW 7 55,784,548 (GRCm39) missense probably benign 0.07
R7614:Herc2 UTSW 7 55,803,023 (GRCm39) nonsense probably null
R7638:Herc2 UTSW 7 55,807,186 (GRCm39) missense probably benign 0.26
R7638:Herc2 UTSW 7 55,870,273 (GRCm39) missense probably damaging 1.00
R7646:Herc2 UTSW 7 55,784,361 (GRCm39) missense probably benign
R7663:Herc2 UTSW 7 55,786,433 (GRCm39) missense probably benign
R7665:Herc2 UTSW 7 55,802,903 (GRCm39) missense probably damaging 1.00
R7691:Herc2 UTSW 7 55,841,593 (GRCm39) missense probably benign
R7733:Herc2 UTSW 7 55,838,412 (GRCm39) missense probably damaging 0.99
R7767:Herc2 UTSW 7 55,878,275 (GRCm39) missense probably benign 0.39
R7802:Herc2 UTSW 7 55,813,838 (GRCm39) missense probably damaging 1.00
R7847:Herc2 UTSW 7 55,807,308 (GRCm39) critical splice donor site probably null
R7956:Herc2 UTSW 7 55,763,148 (GRCm39) missense probably damaging 0.97
R7985:Herc2 UTSW 7 55,814,992 (GRCm39) missense probably benign
R8003:Herc2 UTSW 7 55,818,652 (GRCm39) missense possibly damaging 0.94
R8045:Herc2 UTSW 7 55,834,648 (GRCm39) missense probably damaging 1.00
R8085:Herc2 UTSW 7 55,879,427 (GRCm39) missense probably benign 0.01
R8134:Herc2 UTSW 7 55,734,884 (GRCm39) missense probably benign 0.10
R8259:Herc2 UTSW 7 55,855,638 (GRCm39) missense probably damaging 0.99
R8286:Herc2 UTSW 7 55,879,410 (GRCm39) missense possibly damaging 0.92
R8304:Herc2 UTSW 7 55,809,186 (GRCm39) missense probably damaging 1.00
R8321:Herc2 UTSW 7 55,879,096 (GRCm39) missense possibly damaging 0.84
R8332:Herc2 UTSW 7 55,796,343 (GRCm39) missense probably damaging 1.00
R8432:Herc2 UTSW 7 55,804,860 (GRCm39) missense probably benign 0.14
R8516:Herc2 UTSW 7 55,856,318 (GRCm39) missense probably benign 0.05
R8676:Herc2 UTSW 7 55,838,361 (GRCm39) missense probably damaging 1.00
R8738:Herc2 UTSW 7 55,798,402 (GRCm39) missense possibly damaging 0.78
R8742:Herc2 UTSW 7 55,744,143 (GRCm39) missense probably benign 0.12
R8796:Herc2 UTSW 7 55,785,123 (GRCm39) missense probably benign 0.01
R8825:Herc2 UTSW 7 55,700,626 (GRCm39) start codon destroyed probably null 0.01
R8826:Herc2 UTSW 7 55,756,144 (GRCm39) missense probably benign 0.12
R8842:Herc2 UTSW 7 55,738,059 (GRCm39) missense probably damaging 0.99
R9103:Herc2 UTSW 7 55,784,803 (GRCm39) missense possibly damaging 0.47
R9124:Herc2 UTSW 7 55,834,056 (GRCm39) missense probably damaging 1.00
R9134:Herc2 UTSW 7 55,832,177 (GRCm39) missense probably damaging 0.99
R9168:Herc2 UTSW 7 55,802,208 (GRCm39) missense probably damaging 0.99
R9173:Herc2 UTSW 7 55,856,350 (GRCm39) missense probably damaging 0.97
R9238:Herc2 UTSW 7 55,813,508 (GRCm39) missense probably damaging 0.98
R9249:Herc2 UTSW 7 55,762,890 (GRCm39) missense probably damaging 1.00
R9344:Herc2 UTSW 7 55,772,112 (GRCm39) missense probably benign 0.07
R9432:Herc2 UTSW 7 55,780,932 (GRCm39) missense probably damaging 1.00
R9472:Herc2 UTSW 7 55,813,843 (GRCm39) missense probably damaging 1.00
R9513:Herc2 UTSW 7 55,762,848 (GRCm39) missense probably damaging 1.00
R9579:Herc2 UTSW 7 55,758,500 (GRCm39) missense probably damaging 0.99
R9596:Herc2 UTSW 7 55,834,595 (GRCm39) missense
R9664:Herc2 UTSW 7 55,820,338 (GRCm39) missense possibly damaging 0.90
R9760:Herc2 UTSW 7 55,813,659 (GRCm39) critical splice donor site probably null
R9781:Herc2 UTSW 7 55,750,096 (GRCm39) missense possibly damaging 0.53
RF024:Herc2 UTSW 7 55,876,273 (GRCm39) missense probably damaging 1.00
X0011:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
X0023:Herc2 UTSW 7 55,740,666 (GRCm39) missense possibly damaging 0.73
X0057:Herc2 UTSW 7 55,879,438 (GRCm39) missense probably benign 0.04
X0064:Herc2 UTSW 7 55,841,006 (GRCm39) missense probably benign
X0064:Herc2 UTSW 7 55,840,959 (GRCm39) missense probably benign 0.01
Z1088:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1088:Herc2 UTSW 7 55,737,089 (GRCm39) missense probably benign 0.00
Z1088:Herc2 UTSW 7 55,876,337 (GRCm39) missense probably damaging 1.00
Z1088:Herc2 UTSW 7 55,865,180 (GRCm39) missense probably damaging 1.00
Z1088:Herc2 UTSW 7 55,865,129 (GRCm39) missense possibly damaging 0.86
Z1176:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1176:Herc2 UTSW 7 55,747,281 (GRCm39) missense possibly damaging 0.48
Z1176:Herc2 UTSW 7 55,782,246 (GRCm39) missense probably damaging 1.00
Z1177:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1177:Herc2 UTSW 7 55,771,337 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGTTGTGCCACTGGTAACTCATAGG -3'
(R):5'- TGCCAATGTGATTCACTGGACAGG -3'

Sequencing Primer
(F):5'- cgtctcaaaaatcttactctctctc -3'
(R):5'- GTCATGAACATTCCTGATCTGAGC -3'
Posted On 2013-05-23