Incidental Mutation 'R5309:Spg21'
ID404725
Institutional Source Beutler Lab
Gene Symbol Spg21
Ensembl Gene ENSMUSG00000032388
Gene NameSPG21, maspardin
SynonymsD9Wsu18e, BM-019, GL010, ACP33
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65460947-65488470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65468802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 31 (I31V)
Ref Sequence ENSEMBL: ENSMUSP00000150052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034955] [ENSMUST00000213957] [ENSMUST00000215170]
Predicted Effect probably benign
Transcript: ENSMUST00000034955
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034955
Gene: ENSMUSG00000032388
AA Change: I31V

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Abhydrolase_1 39 171 1.9e-10 PFAM
Pfam:Abhydrolase_5 45 255 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213957
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215170
AA Change: I31V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216992
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation. The interaction with CD4 is mediated by the noncatalytic alpha/beta hydrolase fold domain of this protein. It is thus proposed that this gene product modulates the stimulatory activity of CD4. Mutations in this gene are associated with autosomal recessive spastic paraplegia 21 (SPG21), also known as mast syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Spg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03130:Spg21 APN 9 65473708 missense probably benign 0.01
IGL03358:Spg21 APN 9 65480416 missense probably benign 0.02
R0277:Spg21 UTSW 9 65465347 missense possibly damaging 0.92
R1843:Spg21 UTSW 9 65465336 missense probably damaging 0.99
R1920:Spg21 UTSW 9 65484497 missense probably damaging 1.00
R1959:Spg21 UTSW 9 65484492 missense probably damaging 1.00
R2110:Spg21 UTSW 9 65484429 splice site probably null
R2328:Spg21 UTSW 9 65486873 missense possibly damaging 0.83
R4600:Spg21 UTSW 9 65475975 missense probably benign 0.05
R4614:Spg21 UTSW 9 65480389 unclassified probably null
R5022:Spg21 UTSW 9 65475949 missense probably damaging 1.00
R5312:Spg21 UTSW 9 65468802 missense probably benign
R6179:Spg21 UTSW 9 65468808 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCAGGGCAGCTTATTGTGG -3'
(R):5'- AGAGTTCCCAGTATTATAGCTCG -3'

Sequencing Primer
(F):5'- GCAGCTTATTGTGGGTACTCACC -3'
(R):5'- GCTCGTCAGCGACAGAAG -3'
Posted On2016-07-22