Incidental Mutation 'R5309:Olfr792'
ID404731
Institutional Source Beutler Lab
Gene Symbol Olfr792
Ensembl Gene ENSMUSG00000094496
Gene Nameolfactory receptor 792
SynonymsGA_x6K02T2PULF-11219415-11220350, MOR108-2
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129539162-129542534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129541265 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 243 (M243L)
Ref Sequence ENSEMBL: ENSMUSP00000149872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076575] [ENSMUST00000215436]
Predicted Effect probably benign
Transcript: ENSMUST00000076575
AA Change: M243L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000096707
Gene: ENSMUSG00000094496
AA Change: M243L

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215436
AA Change: M243L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Olfr792
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr792 APN 10 129540842 missense probably benign 0.07
IGL01459:Olfr792 APN 10 129540541 start codon destroyed probably null 1.00
IGL02090:Olfr792 APN 10 129541307 missense probably damaging 1.00
IGL03338:Olfr792 APN 10 129541056 missense probably damaging 0.99
R0382:Olfr792 UTSW 10 129541014 missense probably benign 0.01
R1672:Olfr792 UTSW 10 129540692 missense probably benign 0.00
R2285:Olfr792 UTSW 10 129540668 missense probably benign 0.22
R2938:Olfr792 UTSW 10 129540615 missense probably damaging 1.00
R3498:Olfr792 UTSW 10 129540909 missense probably damaging 1.00
R5312:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R6004:Olfr792 UTSW 10 129540890 missense probably benign 0.31
R6800:Olfr792 UTSW 10 129541263 missense probably damaging 1.00
R7127:Olfr792 UTSW 10 129541067 missense probably damaging 1.00
R7167:Olfr792 UTSW 10 129540738 missense possibly damaging 0.88
R7763:Olfr792 UTSW 10 129541455 missense probably benign
R7819:Olfr792 UTSW 10 129540693 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCATCTCTTGCACAGACAC -3'
(R):5'- GGAAGTACACATCACATACAATGTTCC -3'

Sequencing Primer
(F):5'- TTGCACAGACACAGCCTTCCTAG -3'
(R):5'- TGAGCACTGCTATACCCT -3'
Posted On2016-07-22