Incidental Mutation 'R5309:Exoc7'
ID404734
Institutional Source Beutler Lab
Gene Symbol Exoc7
Ensembl Gene ENSMUSG00000020792
Gene Nameexocyst complex component 7
Synonymssec70, Exo70, 70kDa
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116288001-116307233 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 116305027 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 28 (E28*)
Ref Sequence ENSEMBL: ENSMUSP00000121150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000106411] [ENSMUST00000106413] [ENSMUST00000124281] [ENSMUST00000126731] [ENSMUST00000133468]
Predicted Effect probably null
Transcript: ENSMUST00000021147
AA Change: E50*
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792
AA Change: E50*

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106411
AA Change: E50*
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792
AA Change: E50*

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106413
AA Change: E50*
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792
AA Change: E50*

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124281
Predicted Effect probably null
Transcript: ENSMUST00000126731
AA Change: E43*
SMART Domains Protein: ENSMUSP00000121794
Gene: ENSMUSG00000020792
AA Change: E43*

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
PDB:2PFT|A 78 265 1e-113 PDB
Predicted Effect probably null
Transcript: ENSMUST00000133468
AA Change: E28*
SMART Domains Protein: ENSMUSP00000121150
Gene: ENSMUSG00000020792
AA Change: E28*

DomainStartEndE-ValueType
PDB:2PFT|A 63 105 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181270
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Exoc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Exoc7 APN 11 116301100 splice site probably null
IGL02825:Exoc7 APN 11 116297585 missense probably damaging 0.98
IGL03068:Exoc7 APN 11 116301134 missense possibly damaging 0.70
IGL03333:Exoc7 APN 11 116301161 missense probably benign 0.17
IGL03412:Exoc7 APN 11 116289275 missense possibly damaging 0.57
IGL02799:Exoc7 UTSW 11 116301181 missense probably damaging 1.00
R0022:Exoc7 UTSW 11 116297582 missense possibly damaging 0.62
R0068:Exoc7 UTSW 11 116304906 missense probably damaging 1.00
R0158:Exoc7 UTSW 11 116295292 missense probably benign 0.01
R0362:Exoc7 UTSW 11 116295662 missense probably benign 0.37
R0387:Exoc7 UTSW 11 116294401 unclassified probably benign
R0394:Exoc7 UTSW 11 116300398 missense probably damaging 0.99
R0714:Exoc7 UTSW 11 116293294 missense probably benign 0.16
R0848:Exoc7 UTSW 11 116295248 missense possibly damaging 0.93
R1611:Exoc7 UTSW 11 116295265 missense possibly damaging 0.84
R1795:Exoc7 UTSW 11 116292521 missense probably damaging 0.98
R2259:Exoc7 UTSW 11 116306411 missense probably damaging 1.00
R3911:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3913:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3979:Exoc7 UTSW 11 116296762 missense probably benign 0.30
R4029:Exoc7 UTSW 11 116306988 unclassified probably benign
R4576:Exoc7 UTSW 11 116289183 makesense probably null
R4983:Exoc7 UTSW 11 116289269 missense probably damaging 1.00
R6453:Exoc7 UTSW 11 116293969 splice site probably null
R7275:Exoc7 UTSW 11 116304862 critical splice donor site probably null
X0063:Exoc7 UTSW 11 116304949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACTTGGCTCCATGGGTCC -3'
(R):5'- GACTAGGAGTGCAGTTGTAGC -3'

Sequencing Primer
(F):5'- GAGCTCTGCATGGAACTCAC -3'
(R):5'- GTAGCAAACAAGTCGACTATGTTCC -3'
Posted On2016-07-22