Incidental Mutation 'R5309:Snx13'
ID404735
Institutional Source Beutler Lab
Gene Symbol Snx13
Ensembl Gene ENSMUSG00000020590
Gene Namesorting nexin 13
SynonymsRGS-PX1
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location35047186-35147479 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 35144325 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 956 (Q956*)
Ref Sequence ENSEMBL: ENSMUSP00000038430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048519]
Predicted Effect probably null
Transcript: ENSMUST00000048519
AA Change: Q956*
SMART Domains Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590
AA Change: Q956*

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 98 285 9.09e-102 SMART
coiled coil region 293 320 N/A INTRINSIC
RGS 374 514 4.63e-32 SMART
low complexity region 546 562 N/A INTRINSIC
PX 564 677 2.88e-31 SMART
Pfam:Nexin_C 793 903 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223056
Meta Mutation Damage Score 0.6 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Snx13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snx13 APN 12 35098280 missense probably damaging 1.00
IGL01143:Snx13 APN 12 35132160 missense probably damaging 0.96
IGL01446:Snx13 APN 12 35124480 nonsense probably null
IGL01519:Snx13 APN 12 35138472 unclassified probably benign
IGL01902:Snx13 APN 12 35133307 critical splice acceptor site probably null
IGL01903:Snx13 APN 12 35085969 missense probably benign 0.06
IGL02146:Snx13 APN 12 35101079 missense probably benign 0.00
IGL02175:Snx13 APN 12 35132062 missense possibly damaging 0.83
IGL02197:Snx13 APN 12 35106801 missense probably damaging 1.00
IGL02200:Snx13 APN 12 35086885 missense probably damaging 1.00
IGL02476:Snx13 APN 12 35086941 missense probably damaging 1.00
IGL03171:Snx13 APN 12 35100540 missense probably benign 0.28
jiaozhi UTSW 12 35144220 missense probably damaging 0.98
resistance UTSW 12 35112445 missense probably damaging 1.00
IGL02835:Snx13 UTSW 12 35132127 missense possibly damaging 0.48
P0042:Snx13 UTSW 12 35107542 missense probably damaging 1.00
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0344:Snx13 UTSW 12 35086900 nonsense probably null
R1240:Snx13 UTSW 12 35091406 missense probably damaging 0.99
R1335:Snx13 UTSW 12 35132124 missense probably benign 0.16
R1451:Snx13 UTSW 12 35078984 missense probably benign 0.00
R1617:Snx13 UTSW 12 35086896 missense probably damaging 0.99
R2065:Snx13 UTSW 12 35138066 missense possibly damaging 0.91
R2111:Snx13 UTSW 12 35138085 missense probably damaging 1.00
R2385:Snx13 UTSW 12 35119793 missense probably benign 0.36
R2437:Snx13 UTSW 12 35082927 missense probably benign 0.14
R2511:Snx13 UTSW 12 35138081 missense probably benign 0.13
R2860:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2861:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2862:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2992:Snx13 UTSW 12 35105191 missense probably damaging 1.00
R3938:Snx13 UTSW 12 35144097 missense probably benign 0.10
R4304:Snx13 UTSW 12 35122942 missense probably benign 0.10
R4532:Snx13 UTSW 12 35144220 missense probably damaging 0.98
R4692:Snx13 UTSW 12 35086918 missense possibly damaging 0.82
R4783:Snx13 UTSW 12 35098286 missense probably damaging 1.00
R4914:Snx13 UTSW 12 35132033 missense possibly damaging 0.84
R5425:Snx13 UTSW 12 35100644 nonsense probably null
R5476:Snx13 UTSW 12 35106820 splice site probably null
R5533:Snx13 UTSW 12 35123026 critical splice donor site probably null
R5564:Snx13 UTSW 12 35124472 missense possibly damaging 0.61
R5572:Snx13 UTSW 12 35103120 missense probably damaging 1.00
R5635:Snx13 UTSW 12 35140171 missense probably benign 0.00
R6018:Snx13 UTSW 12 35047319 start gained probably benign
R6612:Snx13 UTSW 12 35106759 missense probably benign 0.19
R6618:Snx13 UTSW 12 35112445 missense probably damaging 1.00
R6737:Snx13 UTSW 12 35140186 missense probably damaging 0.98
R6964:Snx13 UTSW 12 35119789 missense possibly damaging 0.81
R7186:Snx13 UTSW 12 35092913 missense probably damaging 0.99
R7372:Snx13 UTSW 12 35078951 missense probably benign 0.00
R7429:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7430:Snx13 UTSW 12 35133358 missense possibly damaging 0.89
R7537:Snx13 UTSW 12 35085982 missense probably damaging 1.00
R7567:Snx13 UTSW 12 35086914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGAAAGGTATTCTTCGCGTG -3'
(R):5'- ACACAGGACTCTCTTGGTATTGG -3'

Sequencing Primer
(F):5'- AAGGTATTCTTCGCGTGTTTGAAATG -3'
(R):5'- TATTGGTGGATTACAGTTGAAAAGG -3'
Posted On2016-07-22