Incidental Mutation 'R5309:Ipo11'
ID404741
Institutional Source Beutler Lab
Gene Symbol Ipo11
Ensembl Gene ENSMUSG00000042590
Gene Nameimportin 11
SynonymsRanbp11, 1700081H05Rik, 2510001A17Rik, E330021B14Rik
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5309 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location106794439-106936958 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 106833973 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000080856] [ENSMUST00000186033]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057427
SMART Domains Protein: ENSMUSP00000053644
Gene: ENSMUSG00000078933

DomainStartEndE-ValueType
transmembrane domain 99 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080856
SMART Domains Protein: ENSMUSP00000079667
Gene: ENSMUSG00000042590

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186033
SMART Domains Protein: ENSMUSP00000140046
Gene: ENSMUSG00000042590

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190794
Predicted Effect probably benign
Transcript: ENSMUST00000190801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191312
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Supt16 T C 14: 52,162,698 E996G probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Ipo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ipo11 APN 13 106897260 missense probably damaging 1.00
IGL00900:Ipo11 APN 13 106847444 missense possibly damaging 0.81
IGL00971:Ipo11 APN 13 106856769 missense probably damaging 1.00
IGL01023:Ipo11 APN 13 106897259 missense probably benign 0.44
IGL01331:Ipo11 APN 13 106795746 missense possibly damaging 0.92
IGL01608:Ipo11 APN 13 106834494 intron probably benign
IGL02021:Ipo11 APN 13 106857237 missense probably damaging 1.00
IGL02620:Ipo11 APN 13 106876281 critical splice acceptor site probably null
IGL02651:Ipo11 APN 13 106875606 missense probably damaging 1.00
IGL02699:Ipo11 APN 13 106889397 missense possibly damaging 0.94
IGL02928:Ipo11 APN 13 106889355 splice site probably benign
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0032:Ipo11 UTSW 13 106834463 intron probably benign
R0164:Ipo11 UTSW 13 106910194 splice site probably benign
R0333:Ipo11 UTSW 13 106870763 missense probably benign 0.00
R0499:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R0555:Ipo11 UTSW 13 106892461 missense probably damaging 1.00
R0718:Ipo11 UTSW 13 106919611 missense possibly damaging 0.91
R0899:Ipo11 UTSW 13 106900816 nonsense probably null
R1590:Ipo11 UTSW 13 106886717 missense probably damaging 1.00
R1700:Ipo11 UTSW 13 106795662 missense probably benign
R1851:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1852:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1853:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R2012:Ipo11 UTSW 13 106919622 missense probably benign 0.01
R2168:Ipo11 UTSW 13 106879610 splice site probably null
R2183:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R4254:Ipo11 UTSW 13 106892509 missense probably benign 0.00
R4607:Ipo11 UTSW 13 106900811 missense probably damaging 0.98
R4610:Ipo11 UTSW 13 106879737 missense probably benign 0.06
R4654:Ipo11 UTSW 13 106834184 intron probably benign
R4792:Ipo11 UTSW 13 106834160 intron probably benign
R4990:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R5580:Ipo11 UTSW 13 106900747 missense probably benign
R5822:Ipo11 UTSW 13 106848418 unclassified probably benign
R6459:Ipo11 UTSW 13 106865769 intron probably null
R6597:Ipo11 UTSW 13 106865863 critical splice donor site probably null
R6803:Ipo11 UTSW 13 106857258 missense probably benign
R6882:Ipo11 UTSW 13 106900682 splice site probably null
R7071:Ipo11 UTSW 13 106925096 missense probably damaging 1.00
R7202:Ipo11 UTSW 13 106875570 missense probably damaging 1.00
R7214:Ipo11 UTSW 13 106895857 missense probably null
R7221:Ipo11 UTSW 13 106892557 missense probably damaging 1.00
R7392:Ipo11 UTSW 13 106891691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCGTAAGTCATGAGGATTCTG -3'
(R):5'- AGCTTTTATCAGTCAGCAAGGTAC -3'

Sequencing Primer
(F):5'- CTTTAGAGATAAACATGATTTGTGGC -3'
(R):5'- GGTACAATGTAACTGCCTCGG -3'
Posted On2016-07-22