Incidental Mutation 'R5309:Supt16'
ID 404742
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission 042892-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R5309 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52162698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 996 (E996G)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709] [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181017] [ENSMUST00000181401]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: E996G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: E996G

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111600
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111603
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180500
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180901
SMART Domains Protein: ENSMUSP00000137826
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 179 223 N/A INTRINSIC
coiled coil region 274 363 N/A INTRINSIC
Blast:C2 526 654 2e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181017
SMART Domains Protein: ENSMUSP00000137900
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Blast:C2 126 254 2e-41 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181401
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227577
Meta Mutation Damage Score 0.1166 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
A630073D07Rik T C 6: 132,626,577 Q72R unknown Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abcg3 A C 5: 104,936,599 C577G possibly damaging Het
Adamtsl5 A T 10: 80,345,148 probably benign Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdh3 A G 8: 106,539,020 T232A probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Cwh43 A G 5: 73,416,767 H258R probably benign Het
Cyp2j6 T A 4: 96,535,556 I192F probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Egfr G A 11: 16,911,703 G1161S probably benign Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Exoc7 C A 11: 116,305,027 E28* probably null Het
Fam118a C T 15: 85,050,755 T195M probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Gnal G A 18: 67,213,107 R219K possibly damaging Het
Helz2 T A 2: 181,234,846 E1285V probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Ipo11 T C 13: 106,833,973 probably benign Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Larp1 T C 11: 58,050,808 V689A possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mmp9 T A 2: 164,950,795 probably benign Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Osbpl8 T A 10: 111,270,557 V275E probably benign Het
Osbpl9 A G 4: 109,066,155 S520P probably damaging Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Proz T C 8: 13,061,049 L7P probably damaging Het
Ptpn13 G A 5: 103,541,053 S904N probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Shoc2 T C 19: 53,987,733 V18A probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc10a6 A T 5: 103,609,092 C269S probably damaging Het
Slc34a2 A G 5: 53,069,488 E651G probably damaging Het
Snx13 C T 12: 35,144,325 Q956* probably null Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Srpk2 T C 5: 23,525,718 K268E probably damaging Het
Syf2 A G 4: 134,936,069 D184G probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn1r170 T A 7: 23,606,455 I94N probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Vmn2r15 T A 5: 109,293,090 I301F probably damaging Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- AAGCCCACCTGTAGCCTATG -3'
(R):5'- CACCTGTACACGCTTTAAAGGAG -3'

Sequencing Primer
(F):5'- GGACTTACATCACGCAATGCTGTG -3'
(R):5'- CTGTACACGCTTTAAAGGAGAAAAC -3'
Posted On 2016-07-22