Incidental Mutation 'R0009:Trappc11'
ID 40475
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Name trafficking protein particle complex 11
Synonyms D030016E14Rik
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0009 (G1)
Quality Score 220
Status Validated
Chromosome 8
Chromosomal Location 47490115-47533470 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 47503320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 874 (C874S)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]
AlphaFold B2RXC1
Predicted Effect possibly damaging
Transcript: ENSMUST00000039061
AA Change: C874S

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: C874S

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120987
SMART Domains Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

DomainStartEndE-ValueType
Pfam:Gryzun 1 155 4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125065
Meta Mutation Damage Score 0.5087 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,919,633 probably benign Het
Abcg4 T G 9: 44,277,649 probably benign Het
Afm C A 5: 90,545,384 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Aplnr T A 2: 85,137,276 probably null Het
Arih2 T A 9: 108,611,727 H264L probably damaging Het
Atp1a1 A T 3: 101,579,835 I886N possibly damaging Het
Bmf A T 2: 118,549,622 V14E probably damaging Het
Ccdc116 T C 16: 17,144,039 E15G probably damaging Het
Ccdc175 T C 12: 72,135,965 N427D possibly damaging Het
Cfap53 A G 18: 74,299,176 H45R probably benign Het
Chd3 A G 11: 69,349,906 L1569P probably damaging Het
Cntn2 G A 1: 132,516,180 Q457* probably null Het
Coro1a A T 7: 126,701,413 probably benign Het
Cracr2b T A 7: 141,463,759 L91Q probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dip2b T A 15: 100,169,312 L565Q probably damaging Het
Dip2c T A 13: 9,621,903 C1004S probably damaging Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah14 A G 1: 181,769,407 probably benign Het
Dnase1 T C 16: 4,038,946 V147A probably damaging Het
Dusp8 T C 7: 142,082,054 probably benign Het
Fer1l6 T C 15: 58,662,787 Y1828H probably damaging Het
Flvcr1 A G 1: 191,008,191 V544A probably benign Het
Fsd1l T C 4: 53,687,209 V311A probably benign Het
Glud1 G A 14: 34,334,268 G300S probably benign Het
Gm4847 C T 1: 166,630,486 V433I probably benign Het
Gstm3 T G 3: 107,967,840 Y62S probably damaging Het
Gtse1 C T 15: 85,862,435 P151S probably benign Het
Herc2 T C 7: 56,207,812 S4048P probably benign Het
Hp1bp3 T A 4: 138,221,683 I19K probably benign Het
Htr7 C A 19: 36,041,540 probably benign Het
Il1a C T 2: 129,309,074 D10N probably damaging Het
Il22ra2 A T 10: 19,624,458 N39I probably damaging Het
Kcnn4 T C 7: 24,379,255 C267R possibly damaging Het
Larp1 A G 11: 58,055,473 K879R possibly damaging Het
Lcn5 T A 2: 25,661,405 probably benign Het
Lep T A 6: 29,068,972 C7* probably null Het
Magi2 A T 5: 20,611,055 Y747F probably benign Het
Mast4 T C 13: 102,742,058 T1223A probably damaging Het
Mcc C T 18: 44,445,933 E803K probably damaging Het
Mtmr4 T C 11: 87,611,508 I796T probably benign Het
Myef2 A T 2: 125,108,978 D312E probably benign Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Myo19 T A 11: 84,888,169 probably null Het
Naa15 T G 3: 51,470,219 H763Q probably damaging Het
Pde5a C T 3: 122,824,902 probably benign Het
Plpp2 C T 10: 79,527,244 R184H probably benign Het
Rab19 T G 6: 39,389,687 L179V probably damaging Het
Rims2 T A 15: 39,534,966 M1087K probably damaging Het
Riox2 C A 16: 59,489,367 D361E probably benign Het
Sh3rf1 T A 8: 61,226,293 V123E probably damaging Het
Slc35e1 A T 8: 72,484,709 N318K probably damaging Het
Slc9a2 A T 1: 40,763,602 E604V probably benign Het
Srp72 T C 5: 76,987,885 S221P probably damaging Het
Tbx19 A T 1: 165,160,520 S15T possibly damaging Het
Tcea2 A G 2: 181,685,817 T112A probably benign Het
Tesk1 T A 4: 43,445,368 D230E probably damaging Het
Tm4sf5 C T 11: 70,510,712 A179V probably damaging Het
Tnr G T 1: 159,852,416 G320V probably damaging Het
Trpm3 T A 19: 22,914,446 Y885N probably damaging Het
Unc5a T A 13: 55,002,879 C505S probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Xpo5 T C 17: 46,204,786 probably benign Het
Zfp637 C A 6: 117,845,668 H252Q probably damaging Het
Zfp646 T A 7: 127,880,731 D693E probably damaging Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 splice site probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bantu UTSW 8 47498666 missense probably benign 0.44
bunyoro UTSW 8 47512285 splice site probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 splice site probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R7964:Trappc11 UTSW 8 47526944 missense possibly damaging 0.54
R8183:Trappc11 UTSW 8 47529356 missense possibly damaging 0.93
R8282:Trappc11 UTSW 8 47516589 missense probably damaging 0.97
R8733:Trappc11 UTSW 8 47501848 missense probably damaging 1.00
R8782:Trappc11 UTSW 8 47498666 missense probably benign 0.44
R8853:Trappc11 UTSW 8 47529404 missense probably damaging 0.98
R9544:Trappc11 UTSW 8 47519678 missense possibly damaging 0.94
R9709:Trappc11 UTSW 8 47493313 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTGCCCATCTGCTAAGTTACCC -3'
(R):5'- CTGTGACTGACCGATCAGCAGTTC -3'

Sequencing Primer
(F):5'- TCTCTCCCAATAACTCTGAAATGG -3'
(R):5'- TTATGTCACAGAGGTCAGCTCAG -3'
Posted On 2013-05-23