Mutagenetix > Incidental Mutation

Incidental Mutation 'R0009:Trappc11'

40475

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

038304-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0009 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47503320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 874 (C874S)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]

AlphaFold

B2RXC1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039061
AA Change: C874S

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: C874S

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120987

SMART Domains

Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Gryzun	1	155	4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Meta Mutation Damage Score

0.5087

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	G	15: 60,919,633		probably benign	Het
Abcg4	T	G	9: 44,277,649		probably benign	Het
Afm	C	A	5: 90,545,384		probably benign	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Aplnr	T	A	2: 85,137,276		probably null	Het
Arih2	T	A	9: 108,611,727	H264L	probably damaging	Het
Atp1a1	A	T	3: 101,579,835	I886N	possibly damaging	Het
Bmf	A	T	2: 118,549,622	V14E	probably damaging	Het
Ccdc116	T	C	16: 17,144,039	E15G	probably damaging	Het
Ccdc175	T	C	12: 72,135,965	N427D	possibly damaging	Het
Cfap53	A	G	18: 74,299,176	H45R	probably benign	Het
Chd3	A	G	11: 69,349,906	L1569P	probably damaging	Het
Cntn2	G	A	1: 132,516,180	Q457*	probably null	Het
Coro1a	A	T	7: 126,701,413		probably benign	Het
Cracr2b	T	A	7: 141,463,759	L91Q	probably damaging	Het
Ctdspl	T	C	9: 119,020,046		probably null	Het
Dip2b	T	A	15: 100,169,312	L565Q	probably damaging	Het
Dip2c	T	A	13: 9,621,903	C1004S	probably damaging	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah14	A	G	1: 181,769,407		probably benign	Het
Dnase1	T	C	16: 4,038,946	V147A	probably damaging	Het
Dusp8	T	C	7: 142,082,054		probably benign	Het
Fer1l6	T	C	15: 58,662,787	Y1828H	probably damaging	Het
Flvcr1	A	G	1: 191,008,191	V544A	probably benign	Het
Fsd1l	T	C	4: 53,687,209	V311A	probably benign	Het
Glud1	G	A	14: 34,334,268	G300S	probably benign	Het
Gm4847	C	T	1: 166,630,486	V433I	probably benign	Het
Gstm3	T	G	3: 107,967,840	Y62S	probably damaging	Het
Gtse1	C	T	15: 85,862,435	P151S	probably benign	Het
Herc2	T	C	7: 56,207,812	S4048P	probably benign	Het
Hp1bp3	T	A	4: 138,221,683	I19K	probably benign	Het
Htr7	C	A	19: 36,041,540		probably benign	Het
Il1a	C	T	2: 129,309,074	D10N	probably damaging	Het
Il22ra2	A	T	10: 19,624,458	N39I	probably damaging	Het
Kcnn4	T	C	7: 24,379,255	C267R	possibly damaging	Het
Larp1	A	G	11: 58,055,473	K879R	possibly damaging	Het
Lcn5	T	A	2: 25,661,405		probably benign	Het
Lep	T	A	6: 29,068,972	C7*	probably null	Het
Magi2	A	T	5: 20,611,055	Y747F	probably benign	Het
Mast4	T	C	13: 102,742,058	T1223A	probably damaging	Het
Mcc	C	T	18: 44,445,933	E803K	probably damaging	Het
Mtmr4	T	C	11: 87,611,508	I796T	probably benign	Het
Myef2	A	T	2: 125,108,978	D312E	probably benign	Het
Myl3	A	C	9: 110,767,929	D119A	probably damaging	Het
Myo19	T	A	11: 84,888,169		probably null	Het
Naa15	T	G	3: 51,470,219	H763Q	probably damaging	Het
Pde5a	C	T	3: 122,824,902		probably benign	Het
Plpp2	C	T	10: 79,527,244	R184H	probably benign	Het
Rab19	T	G	6: 39,389,687	L179V	probably damaging	Het
Rims2	T	A	15: 39,534,966	M1087K	probably damaging	Het
Riox2	C	A	16: 59,489,367	D361E	probably benign	Het
Sh3rf1	T	A	8: 61,226,293	V123E	probably damaging	Het
Slc35e1	A	T	8: 72,484,709	N318K	probably damaging	Het
Slc9a2	A	T	1: 40,763,602	E604V	probably benign	Het
Srp72	T	C	5: 76,987,885	S221P	probably damaging	Het
Tbx19	A	T	1: 165,160,520	S15T	possibly damaging	Het
Tcea2	A	G	2: 181,685,817	T112A	probably benign	Het
Tesk1	T	A	4: 43,445,368	D230E	probably damaging	Het
Tm4sf5	C	T	11: 70,510,712	A179V	probably damaging	Het
Tnr	G	T	1: 159,852,416	G320V	probably damaging	Het
Trpm3	T	A	19: 22,914,446	Y885N	probably damaging	Het
Unc5a	T	A	13: 55,002,879	C505S	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Xpo5	T	C	17: 46,204,786		probably benign	Het
Zfp637	C	A	6: 117,845,668	H252Q	probably damaging	Het
Zfp646	T	A	7: 127,880,731	D693E	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGTTGCCCATCTGCTAAGTTACCC -3'
(R):5'- CTGTGACTGACCGATCAGCAGTTC -3'

Sequencing Primer
(F):5'- TCTCTCCCAATAACTCTGAAATGG -3'
(R):5'- TTATGTCACAGAGGTCAGCTCAG -3'

Posted On

2013-05-23