Incidental Mutation 'R5310:Olfr1415'
ID404757
Institutional Source Beutler Lab
Gene Symbol Olfr1415
Ensembl Gene ENSMUSG00000057464
Gene Nameolfactory receptor 1415
SynonymsGA_x6K02T2R7CC-81266841-81267776, MOR103-12
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92489101-92496101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92491036 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000145446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071521] [ENSMUST00000204009] [ENSMUST00000204766]
Predicted Effect probably damaging
Transcript: ENSMUST00000071521
AA Change: T240A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084047
Gene: ENSMUSG00000057464
AA Change: T240A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204009
AA Change: T240A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145446
Gene: ENSMUSG00000057464
AA Change: T240A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204766
SMART Domains Protein: ENSMUSP00000144986
Gene: ENSMUSG00000057464

DomainStartEndE-ValueType
Blast:CLECT 1 65 1e-7 BLAST
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Olfr1415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Olfr1415 APN 1 92491583 missense probably damaging 1.00
R0538:Olfr1415 UTSW 1 92491333 missense possibly damaging 0.77
R0924:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R0930:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R1025:Olfr1415 UTSW 1 92491723 missense probably benign 0.19
R1201:Olfr1415 UTSW 1 92491153 missense probably benign 0.04
R1413:Olfr1415 UTSW 1 92490888 missense probably damaging 1.00
R1510:Olfr1415 UTSW 1 92491617 missense probably damaging 1.00
R1846:Olfr1415 UTSW 1 92491100 nonsense probably null
R1850:Olfr1415 UTSW 1 92491402 missense possibly damaging 0.89
R1940:Olfr1415 UTSW 1 92491735 missense probably benign 0.14
R2760:Olfr1415 UTSW 1 92491080 missense probably damaging 0.99
R4066:Olfr1415 UTSW 1 92491189 missense probably damaging 1.00
R4837:Olfr1415 UTSW 1 92490975 missense probably benign 0.39
R5503:Olfr1415 UTSW 1 92491196 missense probably benign 0.07
R5748:Olfr1415 UTSW 1 92491093 missense probably damaging 0.99
R5760:Olfr1415 UTSW 1 92491200 missense possibly damaging 0.95
R5853:Olfr1415 UTSW 1 92491717 missense probably benign 0.00
R5926:Olfr1415 UTSW 1 92491566 missense probably damaging 1.00
R6199:Olfr1415 UTSW 1 92491542 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGGTCCTTTTCACAGCATCC -3'
(R):5'- AATGTCTTGAACCACTTCTTCTGTG -3'

Sequencing Primer
(F):5'- GGGTCCTTTTCACAGCATCCTTAAAC -3'
(R):5'- GAACCACTTCTTCTGTGACATC -3'
Posted On2016-07-22