Incidental Mutation 'R5310:Mgat5'
ID404758
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Namemannoside acetylglucosaminyltransferase 5
Synonyms4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127205015-127488336 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 127387514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405] [ENSMUST00000171405]
Predicted Effect probably null
Transcript: ENSMUST00000038361
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171405
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171405
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190921
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127387467 missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127384806 missense probably benign
IGL01795:Mgat5 APN 1 127469231 missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127412132 missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127397550 missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127382985 missense probably benign 0.00
IGL02621:Mgat5 APN 1 127397589 missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127412131 missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127412223 missense probably damaging 1.00
R0518:Mgat5 UTSW 1 127384847 missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127412248 missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127459979 missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127397641 critical splice donor site probably null
R1712:Mgat5 UTSW 1 127320638 missense probably benign 0.34
R1744:Mgat5 UTSW 1 127479469 missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127459969 missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127459959 missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127397607 missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127469250 missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127446299 missense probably benign 0.00
R2566:Mgat5 UTSW 1 127307004 missense probably benign 0.01
R3498:Mgat5 UTSW 1 127384834 missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127366443 missense probably benign
R4674:Mgat5 UTSW 1 127390758 missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127459912 missense probably damaging 0.97
R5337:Mgat5 UTSW 1 127459921 missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127387392 missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127382939 missense probably benign 0.10
R6042:Mgat5 UTSW 1 127459899 missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127382979 missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127471564 missense probably benign 0.36
R6662:Mgat5 UTSW 1 127469237 missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127320634 missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127390851 missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127382979 missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127365189 missense probably benign
R7142:Mgat5 UTSW 1 127412187 missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127446262 missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127366455 missense probably benign 0.24
X0028:Mgat5 UTSW 1 127366485 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGATCCTTGTTCACCTGGGG -3'
(R):5'- CCTGGTGTTCATTTATGAGGCC -3'

Sequencing Primer
(F):5'- TTCACCTGGGGCTCCTGAC -3'
(R):5'- TCATTTATGAGGCCCCGGGAG -3'
Posted On2016-07-22