Incidental Mutation 'R5310:Rab3gap1'
ID404759
Institutional Source Beutler Lab
Gene Symbol Rab3gap1
Ensembl Gene ENSMUSG00000036104
Gene NameRAB3 GTPase activating protein subunit 1
Synonyms1700003B17Rik, p130, 4732493F09Rik
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127868773-127943868 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 127942373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000037649] [ENSMUST00000212506] [ENSMUST00000212506]
Predicted Effect probably null
Transcript: ENSMUST00000037649
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037649
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131884
Predicted Effect probably null
Transcript: ENSMUST00000212506
Predicted Effect probably null
Transcript: ENSMUST00000212506
Meta Mutation Damage Score 0.9593 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Rab3gap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rab3gap1 APN 1 127930387 splice site probably benign
IGL01467:Rab3gap1 APN 1 127930384 splice site probably null
IGL01554:Rab3gap1 APN 1 127928008 missense possibly damaging 0.82
IGL01773:Rab3gap1 APN 1 127918221 missense possibly damaging 0.64
IGL01866:Rab3gap1 APN 1 127891080 missense probably damaging 1.00
IGL02078:Rab3gap1 APN 1 127868915 splice site probably benign
IGL02251:Rab3gap1 APN 1 127937500 missense probably benign 0.25
IGL02268:Rab3gap1 APN 1 127868958 missense probably damaging 1.00
IGL02274:Rab3gap1 APN 1 127939080 missense probably benign
IGL02372:Rab3gap1 APN 1 127919561 splice site probably benign
IGL02399:Rab3gap1 APN 1 127928103 missense possibly damaging 0.93
IGL02629:Rab3gap1 APN 1 127909863 missense probably benign 0.01
IGL02700:Rab3gap1 APN 1 127938605 missense probably benign 0.06
IGL02748:Rab3gap1 APN 1 127937461 missense probably damaging 0.99
little_bighorn UTSW 1 127891098 critical splice donor site probably null
IGL03048:Rab3gap1 UTSW 1 127937477 missense probably damaging 1.00
R0828:Rab3gap1 UTSW 1 127938185 splice site probably benign
R1382:Rab3gap1 UTSW 1 127942596 missense probably damaging 0.97
R1729:Rab3gap1 UTSW 1 127942486 missense probably damaging 1.00
R1809:Rab3gap1 UTSW 1 127934514 missense probably damaging 0.99
R1990:Rab3gap1 UTSW 1 127942429 missense possibly damaging 0.56
R2001:Rab3gap1 UTSW 1 127903719 missense possibly damaging 0.95
R2041:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R3955:Rab3gap1 UTSW 1 127934517 missense probably damaging 1.00
R4192:Rab3gap1 UTSW 1 127925470 intron probably benign
R4243:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4244:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4354:Rab3gap1 UTSW 1 127915641 missense probably benign 0.02
R4592:Rab3gap1 UTSW 1 127925259 intron probably benign
R4622:Rab3gap1 UTSW 1 127942419 missense probably benign 0.00
R4738:Rab3gap1 UTSW 1 127934436 missense probably damaging 0.99
R4917:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R4918:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R5090:Rab3gap1 UTSW 1 127915678 missense probably benign 0.35
R5197:Rab3gap1 UTSW 1 127889194 missense probably benign
R5580:Rab3gap1 UTSW 1 127930990 missense probably benign 0.01
R6670:Rab3gap1 UTSW 1 127930775 missense probably benign
R6825:Rab3gap1 UTSW 1 127930421 missense probably damaging 1.00
R7024:Rab3gap1 UTSW 1 127891098 critical splice donor site probably null
R7274:Rab3gap1 UTSW 1 127927512 missense probably benign
R7380:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R7583:Rab3gap1 UTSW 1 127930875 missense probably benign 0.03
R7654:Rab3gap1 UTSW 1 127909915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCCTTGCTTTTCAGAGC -3'
(R):5'- TGTACATACGCTGTGGCAG -3'

Sequencing Primer
(F):5'- TGCCTCACTAGTGCCCAAG -3'
(R):5'- GGCAGGGCCTTGGAGTAG -3'
Posted On2016-07-22