Incidental Mutation 'R5310:Cd40'
ID404762
Institutional Source Beutler Lab
Gene Symbol Cd40
Ensembl Gene ENSMUSG00000017652
Gene NameCD40 antigen
SynonymsBp50, Cd40, p50, Tnfrsf5
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165055627-165072948 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 165063563 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017799] [ENSMUST00000073707] [ENSMUST00000081310] [ENSMUST00000140951] [ENSMUST00000154443] [ENSMUST00000184221]
Predicted Effect probably null
Transcript: ENSMUST00000017799
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073707
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081310
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140951
SMART Domains Protein: ENSMUSP00000122981
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 64 97 9.45e-6 SMART
Blast:TNFR 100 121 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153105
Predicted Effect probably benign
Transcript: ENSMUST00000154443
Predicted Effect probably benign
Transcript: ENSMUST00000184221
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Cd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 165062301 missense probably benign 0.23
noelle UTSW 2 165063563 critical splice donor site probably null
R0553:Cd40 UTSW 2 165070741 missense probably benign 0.01
R1115:Cd40 UTSW 2 165070761 missense possibly damaging 0.59
R1134:Cd40 UTSW 2 165070818 missense probably benign 0.44
R2036:Cd40 UTSW 2 165062301 missense probably benign 0.23
R2938:Cd40 UTSW 2 165069702 missense probably benign 0.01
R3034:Cd40 UTSW 2 165062315 missense probably benign 0.02
R4690:Cd40 UTSW 2 165069695 missense possibly damaging 0.68
R5222:Cd40 UTSW 2 165066544 missense probably benign 0.41
R7318:Cd40 UTSW 2 165062335 missense possibly damaging 0.51
Z1088:Cd40 UTSW 2 165063040 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCTTGGGGTAAGAAGCTG -3'
(R):5'- CCAACAGGCTTCTATTAACTAAGC -3'

Sequencing Primer
(F):5'- AGGTGTTCTGTCCTGCCCTG -3'
(R):5'- CAGGCTTCTATTAACTAAGCAGAAG -3'
Posted On2016-07-22