Incidental Mutation 'R5310:Tmem57'
ID404772
Institutional Source Beutler Lab
Gene Symbol Tmem57
Ensembl Gene ENSMUSG00000028826
Gene Nametransmembrane protein 57
Synonyms1110007C24Rik, C61, 9230118A01Rik
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134802759-134853345 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 134837019 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030628] [ENSMUST00000137707] [ENSMUST00000148595]
Predicted Effect probably benign
Transcript: ENSMUST00000030628
SMART Domains Protein: ENSMUSP00000030628
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 662 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136113
Predicted Effect probably benign
Transcript: ENSMUST00000137707
SMART Domains Protein: ENSMUSP00000124477
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 157 2.1e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148595
AA Change: N80D
SMART Domains Protein: ENSMUSP00000125440
Gene: ENSMUSG00000028826
AA Change: N80D

DomainStartEndE-ValueType
Pfam:Macoilin 2 78 7e-48 PFAM
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Tmem57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Tmem57 APN 4 134828206 missense probably damaging 0.96
IGL01062:Tmem57 APN 4 134833297 missense probably damaging 0.97
IGL02249:Tmem57 APN 4 134828312 missense possibly damaging 0.50
IGL02850:Tmem57 APN 4 134828386 missense probably benign 0.12
subtle UTSW 4 134828299 missense probably damaging 1.00
R0400:Tmem57 UTSW 4 134828116 missense probably benign 0.25
R0548:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R0589:Tmem57 UTSW 4 134828217 missense probably benign 0.30
R1536:Tmem57 UTSW 4 134804507 missense probably damaging 1.00
R2063:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R2151:Tmem57 UTSW 4 134811223 missense probably benign 0.00
R2509:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2510:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2511:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R3806:Tmem57 UTSW 4 134830580 missense probably benign 0.00
R3946:Tmem57 UTSW 4 134804481 missense probably damaging 1.00
R4994:Tmem57 UTSW 4 134828299 missense probably damaging 1.00
R4999:Tmem57 UTSW 4 134828133 missense probably benign 0.23
R5169:Tmem57 UTSW 4 134828463 missense probably benign 0.23
R5443:Tmem57 UTSW 4 134833308 nonsense probably null
R5554:Tmem57 UTSW 4 134828134 missense probably benign
R5712:Tmem57 UTSW 4 134828058 missense probably benign 0.06
R6627:Tmem57 UTSW 4 134836343 missense probably damaging 0.98
R7100:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R7448:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
X0062:Tmem57 UTSW 4 134836347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTTCCTGTTTCCTCATAAACC -3'
(R):5'- CAATAGAAGGGTGGCTCTGG -3'

Sequencing Primer
(F):5'- CTTAAAGCTTGCTGGAATGCAG -3'
(R):5'- TCTGGTTTTTAGAGCTCTCCG -3'
Posted On2016-07-22