Incidental Mutation 'R5310:Zfp979'
ID404774
Institutional Source Beutler Lab
Gene Symbol Zfp979
Ensembl Gene ENSMUSG00000066000
Gene Namezinc finger protein 979
Synonyms2610305D13Rik
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5310 (G1)
Quality Score111
Status Validated
Chromosome4
Chromosomal Location147611937-147642513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147613918 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 111 (H111Q)
Ref Sequence ENSEMBL: ENSMUSP00000114677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037565] [ENSMUST00000105720] [ENSMUST00000133006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037565
AA Change: H111Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038153
Gene: ENSMUSG00000066000
AA Change: H111Q

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105720
AA Change: H111Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101345
Gene: ENSMUSG00000066000
AA Change: H111Q

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133006
AA Change: H111Q

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114677
Gene: ENSMUSG00000066000
AA Change: H111Q

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Ap2a1 A G 7: 44,906,065 probably null Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Other mutations in Zfp979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Zfp979 APN 4 147615396 missense probably damaging 0.98
IGL01865:Zfp979 APN 4 147615317 missense probably benign 0.03
IGL02336:Zfp979 APN 4 147615351 missense probably damaging 1.00
R0336:Zfp979 UTSW 4 147613135 missense possibly damaging 0.86
R1365:Zfp979 UTSW 4 147613224 missense probably benign 0.00
R1440:Zfp979 UTSW 4 147614036 missense possibly damaging 0.96
R1714:Zfp979 UTSW 4 147613985 missense probably damaging 1.00
R1796:Zfp979 UTSW 4 147613283 missense probably damaging 0.99
R2155:Zfp979 UTSW 4 147613458 missense possibly damaging 0.86
R3735:Zfp979 UTSW 4 147613482 missense possibly damaging 0.93
R3963:Zfp979 UTSW 4 147613131 missense probably benign 0.34
R3972:Zfp979 UTSW 4 147618419 nonsense probably null
R4471:Zfp979 UTSW 4 147613456 nonsense probably null
R4983:Zfp979 UTSW 4 147613914 missense possibly damaging 0.94
R5805:Zfp979 UTSW 4 147613610 missense probably damaging 0.99
R5861:Zfp979 UTSW 4 147613509 nonsense probably null
R6598:Zfp979 UTSW 4 147613766 missense probably damaging 0.99
R6599:Zfp979 UTSW 4 147613626 missense probably benign 0.40
R6925:Zfp979 UTSW 4 147613542 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTATTGTTTTGTCTCACAATGGG -3'
(R):5'- ACTTACTCCTCATATAAGTAATCCCTG -3'

Sequencing Primer
(F):5'- TGTTTAGAAACCAAAACCTCATCAAG -3'
(R):5'- AAGTAATCCCTGTTATCCCTAATTCC -3'
Posted On2016-07-22