Incidental Mutation 'R0009:Abcg4'
ID 40478
Institutional Source Beutler Lab
Gene Symbol Abcg4
Ensembl Gene ENSMUSG00000032131
Gene Name ATP binding cassette subfamily G member 4
Synonyms 6430517O04Rik
MMRRC Submission 038304-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R0009 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44184485-44199912 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 44188946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034648] [ENSMUST00000160384] [ENSMUST00000161354] [ENSMUST00000162783] [ENSMUST00000161408]
AlphaFold Q91WA9
Predicted Effect probably benign
Transcript: ENSMUST00000034648
SMART Domains Protein: ENSMUSP00000034648
Gene: ENSMUSG00000032131

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 1.6e-49 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160323
Predicted Effect probably benign
Transcript: ENSMUST00000160384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161206
Predicted Effect probably benign
Transcript: ENSMUST00000161354
SMART Domains Protein: ENSMUSP00000124647
Gene: ENSMUSG00000032131

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 4.8e-47 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162783
SMART Domains Protein: ENSMUSP00000123999
Gene: ENSMUSG00000032131

DomainStartEndE-ValueType
Blast:AAA 1 37 9e-20 BLAST
SCOP:d1gcya2 33 64 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161408
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a report allele exhibit increased brain lathosterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T G 15: 60,791,482 (GRCm39) probably benign Het
Afm C A 5: 90,693,243 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aplnr T A 2: 84,967,620 (GRCm39) probably null Het
Arih2 T A 9: 108,488,926 (GRCm39) H264L probably damaging Het
Atp1a1 A T 3: 101,487,151 (GRCm39) I886N possibly damaging Het
Bmf A T 2: 118,380,103 (GRCm39) V14E probably damaging Het
Ccdc116 T C 16: 16,961,903 (GRCm39) E15G probably damaging Het
Ccdc175 T C 12: 72,182,739 (GRCm39) N427D possibly damaging Het
Cfap53 A G 18: 74,432,247 (GRCm39) H45R probably benign Het
Chd3 A G 11: 69,240,732 (GRCm39) L1569P probably damaging Het
Cntn2 G A 1: 132,443,918 (GRCm39) Q457* probably null Het
Coro1a A T 7: 126,300,585 (GRCm39) probably benign Het
Cracr2b T A 7: 141,043,672 (GRCm39) L91Q probably damaging Het
Ctdspl T C 9: 118,849,114 (GRCm39) probably null Het
Dip2b T A 15: 100,067,193 (GRCm39) L565Q probably damaging Het
Dip2c T A 13: 9,671,939 (GRCm39) C1004S probably damaging Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah14 A G 1: 181,596,972 (GRCm39) probably benign Het
Dnase1 T C 16: 3,856,810 (GRCm39) V147A probably damaging Het
Dusp8 T C 7: 141,635,791 (GRCm39) probably benign Het
Fer1l6 T C 15: 58,534,636 (GRCm39) Y1828H probably damaging Het
Flvcr1 A G 1: 190,740,388 (GRCm39) V544A probably benign Het
Fsd1l T C 4: 53,687,209 (GRCm39) V311A probably benign Het
Glud1 G A 14: 34,056,225 (GRCm39) G300S probably benign Het
Gm4847 C T 1: 166,458,055 (GRCm39) V433I probably benign Het
Gstm3 T G 3: 107,875,156 (GRCm39) Y62S probably damaging Het
Gtse1 C T 15: 85,746,636 (GRCm39) P151S probably benign Het
Herc2 T C 7: 55,857,560 (GRCm39) S4048P probably benign Het
Hp1bp3 T A 4: 137,948,994 (GRCm39) I19K probably benign Het
Htr7 C A 19: 36,018,940 (GRCm39) probably benign Het
Il1a C T 2: 129,150,994 (GRCm39) D10N probably damaging Het
Il22ra2 A T 10: 19,500,206 (GRCm39) N39I probably damaging Het
Kcnn4 T C 7: 24,078,680 (GRCm39) C267R possibly damaging Het
Larp1 A G 11: 57,946,299 (GRCm39) K879R possibly damaging Het
Lcn5 T A 2: 25,551,417 (GRCm39) probably benign Het
Lep T A 6: 29,068,971 (GRCm39) C7* probably null Het
Magi2 A T 5: 20,816,053 (GRCm39) Y747F probably benign Het
Mast4 T C 13: 102,878,566 (GRCm39) T1223A probably damaging Het
Mcc C T 18: 44,579,000 (GRCm39) E803K probably damaging Het
Mtmr4 T C 11: 87,502,334 (GRCm39) I796T probably benign Het
Myef2 A T 2: 124,950,898 (GRCm39) D312E probably benign Het
Myl3 A C 9: 110,596,997 (GRCm39) D119A probably damaging Het
Myo19 T A 11: 84,778,995 (GRCm39) probably null Het
Naa15 T G 3: 51,377,640 (GRCm39) H763Q probably damaging Het
Pde5a C T 3: 122,618,551 (GRCm39) probably benign Het
Plpp2 C T 10: 79,363,078 (GRCm39) R184H probably benign Het
Rab19 T G 6: 39,366,621 (GRCm39) L179V probably damaging Het
Rims2 T A 15: 39,398,362 (GRCm39) M1087K probably damaging Het
Riox2 C A 16: 59,309,730 (GRCm39) D361E probably benign Het
Sh3rf1 T A 8: 61,679,327 (GRCm39) V123E probably damaging Het
Slc35e1 A T 8: 73,238,553 (GRCm39) N318K probably damaging Het
Slc9a2 A T 1: 40,802,762 (GRCm39) E604V probably benign Het
Srp72 T C 5: 77,135,732 (GRCm39) S221P probably damaging Het
Tbx19 A T 1: 164,988,089 (GRCm39) S15T possibly damaging Het
Tcea2 A G 2: 181,327,610 (GRCm39) T112A probably benign Het
Tesk1 T A 4: 43,445,368 (GRCm39) D230E probably damaging Het
Tm4sf5 C T 11: 70,401,538 (GRCm39) A179V probably damaging Het
Tnr G T 1: 159,679,986 (GRCm39) G320V probably damaging Het
Trappc11 A T 8: 47,956,355 (GRCm39) C874S possibly damaging Het
Trpm3 T A 19: 22,891,810 (GRCm39) Y885N probably damaging Het
Unc5a T A 13: 55,150,692 (GRCm39) C505S probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Xpo5 T C 17: 46,515,712 (GRCm39) probably benign Het
Zfp637 C A 6: 117,822,629 (GRCm39) H252Q probably damaging Het
Zfp646 T A 7: 127,479,903 (GRCm39) D693E probably damaging Het
Other mutations in Abcg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Abcg4 APN 9 44,186,439 (GRCm39) splice site probably benign
IGL00585:Abcg4 APN 9 44,192,920 (GRCm39) missense probably benign 0.04
IGL02016:Abcg4 APN 9 44,198,647 (GRCm39) missense probably damaging 0.99
IGL02085:Abcg4 APN 9 44,192,854 (GRCm39) critical splice donor site probably null
IGL02142:Abcg4 APN 9 44,189,014 (GRCm39) missense probably benign 0.18
IGL02171:Abcg4 APN 9 44,186,306 (GRCm39) unclassified probably benign
IGL02309:Abcg4 APN 9 44,193,125 (GRCm39) missense probably benign 0.21
IGL02882:Abcg4 APN 9 44,188,786 (GRCm39) nonsense probably null
R0023:Abcg4 UTSW 9 44,186,672 (GRCm39) missense probably damaging 0.99
R0481:Abcg4 UTSW 9 44,190,666 (GRCm39) missense probably benign 0.07
R0513:Abcg4 UTSW 9 44,192,984 (GRCm39) missense possibly damaging 0.61
R0644:Abcg4 UTSW 9 44,185,996 (GRCm39) missense possibly damaging 0.87
R0649:Abcg4 UTSW 9 44,189,330 (GRCm39) missense probably benign 0.00
R1084:Abcg4 UTSW 9 44,188,766 (GRCm39) missense probably benign 0.27
R1518:Abcg4 UTSW 9 44,186,666 (GRCm39) missense probably benign 0.05
R1528:Abcg4 UTSW 9 44,186,020 (GRCm39) missense probably damaging 0.99
R1702:Abcg4 UTSW 9 44,186,370 (GRCm39) missense probably damaging 0.99
R1932:Abcg4 UTSW 9 44,190,691 (GRCm39) missense probably benign 0.16
R4477:Abcg4 UTSW 9 44,186,383 (GRCm39) missense probably damaging 1.00
R4661:Abcg4 UTSW 9 44,198,627 (GRCm39) missense probably damaging 1.00
R4883:Abcg4 UTSW 9 44,190,616 (GRCm39) missense probably damaging 1.00
R4901:Abcg4 UTSW 9 44,188,954 (GRCm39) critical splice donor site probably null
R5039:Abcg4 UTSW 9 44,192,863 (GRCm39) missense probably damaging 1.00
R5209:Abcg4 UTSW 9 44,186,672 (GRCm39) missense probably damaging 0.99
R5329:Abcg4 UTSW 9 44,190,842 (GRCm39) missense probably benign 0.00
R5492:Abcg4 UTSW 9 44,189,355 (GRCm39) missense probably benign 0.01
R5521:Abcg4 UTSW 9 44,190,980 (GRCm39) unclassified probably benign
R5558:Abcg4 UTSW 9 44,192,705 (GRCm39) missense probably damaging 0.99
R5625:Abcg4 UTSW 9 44,189,333 (GRCm39) missense probably benign 0.42
R6318:Abcg4 UTSW 9 44,186,645 (GRCm39) missense probably benign
R7060:Abcg4 UTSW 9 44,186,425 (GRCm39) missense probably benign 0.13
R7129:Abcg4 UTSW 9 44,190,681 (GRCm39) missense probably benign 0.03
R7431:Abcg4 UTSW 9 44,185,997 (GRCm39) missense possibly damaging 0.87
R7452:Abcg4 UTSW 9 44,190,897 (GRCm39) missense probably damaging 1.00
R8463:Abcg4 UTSW 9 44,192,909 (GRCm39) missense probably damaging 0.99
R8960:Abcg4 UTSW 9 44,186,063 (GRCm39) nonsense probably null
R8978:Abcg4 UTSW 9 44,192,395 (GRCm39) missense probably benign 0.05
R9144:Abcg4 UTSW 9 44,192,708 (GRCm39) missense possibly damaging 0.79
X0028:Abcg4 UTSW 9 44,185,931 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTTGGGATGAGACACGCCACTAC -3'
(R):5'- ACCCACTTGCGGTTCATGTCAC -3'

Sequencing Primer
(F):5'- TGTTCCACAAGACTCACCTGG -3'
(R):5'- TGTCACATGTGTTGATCGGC -3'
Posted On 2013-05-23